Bonjour, cliquez-ici pour vous inscrire et participer au forum.
  • Login:



+ Répondre à la discussion
Affichage des résultats 1 à 8 sur 8

Technique PCR

  1. Freders

    Date d'inscription
    janvier 2008
    Âge
    24
    Messages
    165

    Smile Technique PCR

    Bonjour,
    Besoin d'un peu d'aide pour un exo sur la PCR.

    "On représente les séquences nucléotidiques encadrant une séquence d'ADN de 245 pb dont l'enchainement de nucléotides n'est pas précisé :

    5'- AAATTCGTATGCTGGGCCTAATC [295pb] TAGCCTAGGGTTACTATTTCAACCCGG -3'

    On souhaite amplifier in vitro cette région du génome en utilisant la technique PCR."
    Les 2 amorces sont :
    A : GGGTTGAAATAGTAACCC
    B: AAATTCGTATGCTGGGCC

    Pourquoi, pour l'amorce 1, on a "supprimé" les 2ers nucléotides GG ? Pour moi l'amorce aurait du être CCGGGTTGAAATAGTAACCC.
    C'est le 1er problème.

    Puis, on me demande "quelle sera la taille du fragment d'ADN amplifié?"
    On serait tenté de dire 281pb en comptant seulement les amorces, mais la réponse est 293pb car il faut compter l'ensemble.
    Encore une fois, pourquoi a-t-on supprimé les 2er nucléotides GG, car cela aurait du faire 295pb

    L'explication doit être sûrement toute simple, mais je ne la trouve pas.
    Je compte sur vous


     


    • Publicité



  2. Marina dsf

    Date d'inscription
    janvier 2009
    Localisation
    Lançon de provence
    Âge
    28
    Messages
    6

    Re : Technique PCR

    Bonsoir à toi Fredres,
    Il me semble que la longueur du fragment amplifié correspond au nombre de dNTP compris entre tes deux amorces.

    5'- AAATTCGTATGCTGGGCCTAATC [295pb] TAGCCTAGGGTTACTATTTCAACCCGG -3'

    Amorce A
    Amorce B

    Si ton [295pb] est une série de dNTP compris entre tes deux amorces, je dirais qui faut que tu ajoutes TAATC (5) et TAGCCTA (7).
    Donc moi j'aurai donné un nombre bien supérieur a savoir 307, mais étant donné que moi et la Bio.Mol. on est pas très très pote, je te dirais de voir ce qu'en disent les autres utilisateurs.
    (Comme ça, si j'ai pas pigé le truc moi non plus j'aurais mon explication lol)

    Voilà bonne soirée !
    PS: je ne sais pas du tout pourquoi les deux G en 3' on était virés les pauvres
     

  3. Freders

    Date d'inscription
    janvier 2008
    Âge
    24
    Messages
    165

    Re : Technique PCR

    Euh mince je me suis trompé, c'est :

    5'- AAATTCGTATGCTGGGCCTAATC [245pb] TAGCCTAGGGTTACTATTTCAACCCGG -3'

    ce qui donne 245pb + ce qui a avant et ce qui a après = 293pb

    Oui j'ai bien compris le principe de la PCR mais je ne comprend pas pourquoi les 2 G sont partis.

    Merci quand même
     

  4. MaliciaR

    Date d'inscription
    août 2007
    Localisation
    Europe
    Messages
    3 401

    Re : Technique PCR

    Pour les deux G, tu ne sais pas ce qu'il y a apres. Parfois, si la sequence est un peu "bizarre", tu ne fais pas les amorces continuer pour ne pas avoir des problemes d'appariement. Ou tout simplement, tu essaies que tes amorces ne fassent pas 100 nt non plus Ici, elles ont une taille raisonnable (18 nt), je suppose des Tm compatibles, alors que ce n'est ptet pas le cas avec les 2 G. Ca peut etre un bon exo ca, d'ailleurs : calcule les Tm et regarde ce qu'il en est avec et sans les 2 G.
    An expert is one who knows more and more about less and less.
     

  5. Freders

    Date d'inscription
    janvier 2008
    Âge
    24
    Messages
    165

    Re : Technique PCR

    Tm = (nA + nT) * 2°C + (nG + nC) * 4°C

    Amorce 1 : 9 * 2°C + 9 * 4°C = 54°C
    Amorce 2 : 10 * 2°C + 8 * 4°C = 52°C (sans les 2G)

    Amorce 2 : 10 * 2°C + 10 * 4°C = 60°C (avec les 2G)

    C'est sûrement pour avoir un Tm le + proche possible que les 2G ont été supprimés...
    Merci
     


    • Publicité



  6. MaliciaR

    Date d'inscription
    août 2007
    Localisation
    Europe
    Messages
    3 401

    Re : Technique PCR

    Citation Envoyé par Freders Voir le message
    C'est sûrement pour avoir un Tm le + proche possible que les 2G ont été supprimés...
    Merci
    Voila que tout a une explication.
    An expert is one who knows more and more about less and less.
     

  7. Freders

    Date d'inscription
    janvier 2008
    Âge
    24
    Messages
    165

    Re : Technique PCR

    Ok Merci de m'avoir aidé
     

  8. Marina dsf

    Date d'inscription
    janvier 2009
    Localisation
    Lançon de provence
    Âge
    28
    Messages
    6

    Re : Technique PCR

    C'est ce que je m'etais dit apres avoir posté, je suis allé voir si les Tm etaient Ok, c'etait le cas, mais je ne pensais pas qu'on avait le droit de "bidouiller" comme ca les amorces lol.
    Bonne continuation, et bons exam's si c'est le cas pour certain d'entre vous.
    Pour ma part mon exam de bio mol d'aujourd'hui a été annulé pour cause d'intempéries: Yahou !
     


    • Publicité




Poursuivez votre recherche :




Sur le même thème :




 

Discussions similaires

  1. [Biologie Moléculaire] PCR en temps réel ou Q-PCR
    Par belouga7 dans le forum Biologie
    Réponses: 4
    Dernier message: 22/10/2008, 19h09
  2. Technique de RACE-PCR?
    Par aaricia8 dans le forum Biologie
    Réponses: 7
    Dernier message: 24/05/2008, 14h17
  3. [Biologie Moléculaire] Pcr
    Par okert dans le forum Biologie
    Réponses: 5
    Dernier message: 12/12/2007, 14h48
  4. [Biologie Moléculaire] [Méthodologie] Question technique sur la RT-PCR
    Par John78 dans le forum Biologie
    Réponses: 2
    Dernier message: 09/01/2004, 17h57