Répondre à la discussion
Affichage des résultats 1 à 27 sur 27

ADN brin codant????



  1. #1
    tite rose

    ADN brin codant????

    Bonjour,

    Je souhaiterai comprendre l'ambiguité "brin codant" ; "brin non transcrit" ; "brin transcrit"...
    Comment déterminer qui est quoi...?

    L'ARNm fait la transcription sur lequel..?

    Si on me présente les deux brins complémentaires de l'ADN en me demandant de transcrire l'ARNm correspondant, comment savoir lequel des deux prendre...? Celui qui va de 3' à 5'...? (tout simplement??!)

    Merci BEAUCOUP à ceux qui pourront m'éclairer sur ces quelques questions... ^^

    tite rose.

    -----


  2. Publicité
  3. #2
    Effie

    Re : ADN brin codant????

    Le brin qui subit la transcription est le brin transcrit = brin non codant (le brin codant est celui qui a la même séquence que l'ARNm, en remplaçant T par U).
    la transcription consiste à synthétiser un brin d'ARNm: l'ARN polymérase ne peut travailler que dans le sens 5'-3', le brin d'ADN qui sert de matrice (le brin transcrit) est antiparallèle donc doit être lu dans le sens 3'-5'.
    Si la séquence d'ADN présentée contient la séquence codant pour le début de la protéine, il faut rechercher quel codon, lu dans le sens 3'-5', donnera le codon AUG sur l'ARNm (codon initiateur de la traduction, qui correspond à la méthionine).
    J'espère que ces réponses t'aideront!

  4. #3
    tite rose

    Re : ADN brin codant????

    Olala... non j'y comprends décidemment rien.....
    J'ai beau relire mes cours, et tout ce que je peux trouver a ce sujet, je m'embrouilles.....

    Le probleme est que si on me donne les 2 brins ADN me demandant d'ARNm correspondant, je dois prendre lequel?? On me proposera automatiquement un brin présentant le codon méthionine...??

    Car si c'est le cas, il suffit alors que j'apprenne par coeur les codont methionine, et peu importe de reconnaitre et comprendre "brin codant", "brin transcrit".. etc...
    Dès que j'ai le brin avec la methionine, je ne regarde plus que ce brin là et que fais la complémentarité des bases, avec T-->U....?

    Merci d'avance !!

  5. #4
    zimzum18

    Re : ADN brin codant????

    En cas de devoir en cours c'est obliger qu'il y aura des indications pour savoir ou est le brin matrice

  6. #5
    pommier

    Re : ADN brin codant????

    Bonsoir
    Le plus simple serait d'éviter le terme brin codant et de n'utiliser que brin transcrit.
    Dans un devoir, je pense que l'indication doit être sans ambiguité.

  7. A voir en vidéo sur Futura
  8. #6
    bipbip44

    Re : ADN brin codant????

    Je trouve l'annalogie avec photo\négatif pas mal pour comprendre:
    Tu veux une reproduction d'une photo, donc la photo est le brin codant (identique à ce que tu veux obtenir) mais tu ne peux pas obtenir la reproduction directement à paritr de cette photo, c'est le brin non transcrit. Pour reproduire la photo, il faut transcrire le négatif (brin transcrit = brin non codant).
    J'espère que c'est un peu plus clair...

  9. Publicité
  10. #7
    Effie

    Re : ADN brin codant????

    Citation Envoyé par tite rose Voir le message
    Le probleme est que si on me donne les 2 brins ADN me demandant d'ARNm correspondant, je dois prendre lequel?? On me proposera automatiquement un brin présentant le codon méthionine...??

    Car si c'est le cas, il suffit alors que j'apprenne par coeur les codont methionine, et peu importe de reconnaitre et comprendre "brin codant", "brin transcrit".. etc...
    Dès que j'ai le brin avec la methionine, je ne regarde plus que ce brin là et que fais la complémentarité des bases, avec T-->U....?

    Merci d'avance !!
    Ne panique pas, il n'y a qu'un codon codant pour la méthionine, c'est AUG. De plus, tu as généralement dans ces exercices le tableau du code génétique!

    Je ne vois pas trop ce que tu ne comprends pas dans l'appelation "transcrit" et "codant": le brin transcrit est celui qui subit la transcription, et on peut l'appeler aussi non codant, c'est tout!

    Maintenant, pour être plus à l'aise dans la manipulation de ces concepts et dans leurs applications, tu peux nous soumettre un exercice et ta solution (ou tes démarches pour tenter de le résoudre), on te fera une correction. je pense qu'à partir d'un exemple concret il sera plus simple de trouver ce qui te bloque.

  11. #8
    tite rose

    Re : ADN brin codant????

    Ouf !! Merci pour vos nombreuses réponses !!!
    L'histoire de la photo m'éclaire pas mal en effet !!
    Et il y a quelques phrases "choc" dans vos différentes réponses qui me font beaucoup mieux comprendre la chose...!

    exple :
    "le brin transcrit est celui qui subit la transcription, et on peut l'appeler aussi non codant, c'est tout!"
    Ou encore le fait qu'il y a obligatoirement le codon méthionine dans un exo.

    Pour la petite info, je n'ai pas de DS concernant ce theme... Mais je passe mes concours paramedicaux a la fin de semaine et ce chapitre me hante un peu...! (et je ne venais pas de S mais ES).

    Donc en gros, dans les concours, soit j'aurai un exo "type bac", et a ce moment là en général les questions "tiroirs" permettent d'avancer...
    Mais dans le cas des QCM, c'est souvent réduit au plus simple énoncé.

    Je vous cite l'exemple qui m'a perturbé :

    Dans un énoncé de QCM il n'y avait qu'UN SEUL brin d'ADN, puis on demandé la transcription ARN.
    Tout betement, j'ai transcrit.
    En fait, a la correction j'ai appris qu'il fallait dabord rédiger le brin complémentaire, et faire la transcription sur ce dernier...
    Et c'est là que j'ai beuggé.... Comment savoir...?!

    Donc j'imagine maintenant que la solution se trouve dans la découverte ou non de ce fameux codon AUG lors de la transciption... Si ce n'est pas le cas, je fais la complémentarité et alors je devrais le trouver sur mon 2eme brin..
    C'est bien celà???

    ^^

    merci !

  12. #9
    Effie

    Re : ADN brin codant????

    Dans les concours paramédicaux:
    -soit on te donne une indication sur le brin (exemple: on te dit que c'est le brin non transcrit)
    -soit on te donne une indication sur la place de la séquence; par exemple, que cette séquence code pour le début de la protéine (dans ce cas tu auras un codon AUG à trouver dans l'ARNm), ou alors que cette séquence code pour la fin de la protéine (dans ce cas, ton ARNm devra comporter un codon stop).

    Voici un exemple (tiré d'un concours kiné)
    :
    on a isolé un fragment d'ADN contenant le début de la phase codant du gène correspondant à une protéine humaine composée de 106 acides aminés
    Brin A:ggtatgatccagcaaacctac
    Brin b:ccatactaggtcgtttggatg
    1) identifiez précisément le début de la phase codante du gène en justifiant votre réponse
    2) écrivez la séquence nucléotidique de l'ARNm codan pour le début de la protéine
    3) déduisez grâce au code génétique les 3 premiers acides aminés de la séquence de la protéine fonctionnelle

    Allez, bon courage!!!

  13. #10
    tite rose

    Re : ADN brin codant????

    Brin A: GGT ATG ATC CAG CAA ACC TAC
    Brin b: CCA TAC TAG GTC GTT AGG ATG

    1) Je cherche donc le codon AUG.
    Donc ARN du brin a :
    CCA UAC UAG GUC GUU UGG AUG
    --> codon AUG à la fin...bizarre..

    ARN du brin b :
    GGU AUG AUC CAG CAA UCC UAC.
    --> codon AUG au début..

    Bon, admettons alors que le "bon" ARN est celui du brin b.

    2) Alors l'ARNm codant pour le début de la protéine est :
    AUG AUC CAG CAA UCC UAC

    3) Les protéines seront :
    Methionine - Isoleucine - Glutamine - Glutamine - Sérine - Tyrosine.


    Bon, je rame un peu quand meme pour choisir le bon brin d'ADN.........
    Car là, autant tout est faux...!


    Merci d'avance !!


  14. #11
    Yoyo

    Re : ADN brin codant????

    Citation Envoyé par tite rose Voir le message
    Brin A: GGT ATG ATC CAG CAA ACC TAC
    Brin b: CCA TAC TAG GTC GTT AGG ATG

    1) Je cherche donc le codon AUG.
    Donc ARN du brin a :
    CCA UAC UAG GUC GUU UGG AUG
    --> codon AUG à la fin...bizarre..
    Il est pas a la fin mais au debut! le brin complementaire se lit de droite a gauche (on lit un brin toujours de 5' -> 3' et les brin sont anti-paralleles). donc ca n'est pas un codon AUG mais un codon GUA!
    3) Les protéines seront :
    Non ce sont les acides aminés que tu cites pas les proteines.

    Yoyo

  15. #12
    tite rose

    Re : ADN brin codant????

    Olala......
    Pour les protéines, en effet, me suis trompée par mégarde.

    Par contre..... pour la transcription.... arf...
    Donc c'est effectivement le brin B qui donne l'ARN... pour ca je me suis pas trompée...?

    Dans le cas présent, concernant le brin A, vu qu'on ne m'indique pas les 3' et 5', comment je fais pour déterminer lequel va dans quel sens alors....? Car si par malchance, au lieu que le "faux" AUG se trouve a la fin mais au début, et qu'il y en a un autre un peu plus loin sur le deuscieme brin, je ne saurai lequel choisir... (sans les 3' et 5').


    J'en déduis pour le cas présent que :

    Brin A: 3' GGT ATG ATC CAG CAA ACC TAC 5'
    Brin b: 5' CCA TAC TAG GTC GTT AGG ATG 3'

    pom pom pom....!

  16. Publicité
  17. #13
    Yoyo

    Re : ADN brin codant????

    salut

    et non c'est l'inverse par convention le brin superieur est toujours orienté de 5'->3' de gauche a droite.

    yoyo

  18. #14
    Effie

    Re : ADN brin codant????

    Résumons:

    - par convention, lorsqu'on te présente un ADN double brin, le brin du haut est orienté 5'-3' (donc l'autre brin qui est antiparallèle sera dans le sens 3'-5'.)
    L'ARN polymérase synthétise un brin antiparallèle à partir de la matrice d'ADN, elle synthétise dans le sens 5'-3': tu dois donc lire le brin matrice (le brin transcrit) dans le sens 3'-5'. (Si au concours on te présente un brin que l'on te dit être le brin transcrit, il est orienté dans le bon sens pour être lu de gauche à droite par l'ARN polymérase).

    - par complémentarité des bases, tu cherches à retrouver ce qui donnera le codon initiateur AUG sur l'ARN (tu cherches donc le codon TAC sur le brin transcrit, lu dans le sens 3'-5'). C'est donc le second codon du brin b, le brin b est le brin transcrit.

    - les 3 premiers acides aminés de la protéine fonctionnelle ne contiennent pas la méthionine: la traduction commence au codon AUG, donc le premier acide aminé du polypeptide synthétisé est la méthionine. Les protéines subissent ensuite une maturation avant de devenir fonctionnelles, au cours de laquelle cette méthionine est supprimée.

    Comprends-tu un peu mieux ce qu'on peut te demander au concours, et comment résoudre ce genre d'exercice?

  19. #15
    hussein

    Re : ADN brin codant????

    Salut
    je vois que tout est mélangé là c pour eclaircir
    http://fr.wikipedia.org/wiki/Image:Prot%C3%A9ines.png
    et Dans l 'exercice je trouve qu il est mal fait

  20. #16
    Effie

    Re : ADN brin codant????

    Je suis d'accord que cet exercice est "mal fait", mais c'est souvent le cas dans les concours paramédicaux: le but est d'éliminer un grand nombre de candidats, alors la pédagogie n'est pas leur priorité!!!

  21. #17
    mathoune

    Re : ADN brin codant????

    bonjours!
    Alors moi j'ai un petit soucis avec un exercice.
    dans cette exercice un me donne déjà brin informatif d'ADN et on me demande après de reconstituez en expliquant ma démarche le brin d'ADN non codant.
    Mais un brin informatif et un brin d'adn non codant ce n'est pas la même chose?

  22. #18
    maths33

    Re : ADN brin codant????

    Citation Envoyé par Effie Voir le message
    Si la séquence d'ADN présentée contient la séquence codant pour le début de la protéine, il faut rechercher quel codon, lu dans le sens 3'-5', donnera le codon AUG sur l'ARNm (codon initiateur de la traduction, qui correspond à la méthionine).
    Bonjour,

    J'ai besoin de précisions concernant ce qui a été dit.
    Pouvez-vous me dire si c'est juste ou pas :


    initiation : ARN=AUG ; brin transcrit= TAC ; codant=ATG

    stop : UAA ATT TAA
    UGA ACT TGA
    UAG ATC TAG

    Une autre question: en sachant que les codons cystéines sont UGU et UGC, ce qui correspond sur l'ADN et qui donne la cystéine c'est TGT et TGC, pour moi ceci est le brin codant alors que normalement c'est le brin transcrit qui donne l'ARN...
    Est ce que quelqu'un pourrait m'eclairer svp ?? Merci d'avance.
    Dernière modification par maths33 ; 14/12/2012 à 15h19.

  23. Publicité
  24. #19
    maths33

    Re : ADN brin codant????

    je refais quelque chose d'un peu mieux:

    pour l'initiation:
    ARN=AUG ; brin transcrit=TAC ; codant=ATG

    pour le codon STOP:
    ARN=UAA ; transcrit=ATT ; codant=TAA
    ARN=UGA ; transcrit=ACT ; codant=TGA
    ARN=UAG ; transcrit=ATC ; codant= TAG

  25. #20
    Htu

    Re : ADN brin codant????

    Salut Math33.

    pour l'initiation:
    ARN=AUG ; brin transcrit=TAC ; codant=ATG

    pour le codon STOP:

    ARN=UAA ; transcrit=ATT ; codant=TAA
    ARN=UGA ; transcrit=ACT ; codant=TGA
    ARN=UAG ; transcrit=ATC ; codant= TAG
    Oui ! (Ton ARN sera toujours la même séquence que ton brin codant, avec comme différence le T en U.)


    Une autre question: en sachant que les codons cystéines sont UGU et UGC, ce qui correspond sur l'ADN et qui donne la cystéine c'est TGT et TGC, pour moi ceci est le brin codant alors que normalement c'est le brin transcrit qui donne l'ARN...
    Tes deux affirmations sont justes !

    Il faut que tu ordonnes les choses dans ta tête.

    > Le brin transcrit est celui sur lequel va se fixer l'enzyme, et par conséquent, celui à partir duquel sera synthétisé l'ARN.

    > Le brin codant lui, aura la même séquence que l'ARN qui va être synthétisée. (Avec les T, non pas les U pour le brins codant)

    Une petite note qui pourrait t'aider est la suivante :

    Le brin codant est orienté 5' - 3'. 5' ATTGGCGTACGTAC 3'
    Le brin transcrit est ortienté 3' - 5'. 3' TAACCGCATGCATG 5'
    L'ARN polymérase fonctionne de 5' en 3' en ajoutant des nucléotides complétmentaires à ceux qu'elle rencontre. (Donc si ARN polymérase rencontre un A, elle va mettre un U. Si elle rencontre un G elle va mettre un C etc...)

    ARN à partir du brin transcrit : 5' AUUCCGCAUGCAUG 3' (Tu retrouves le brin codant avec des U remplaçant les T)

    DONC, pour avoir la même séquence que le brin 5' - 3', il faut que l'ARN polymérase 'lise' le brin antiparallèle (donc le brin transcrit) ! (Comprends tu cela? Si oui, une majeure partie de tes problèmes est résolue !)

    En espérant t'avoir éclairci la chose !

    Bonne soirée, et n'hésite pas si d'autres questions te préoccupent ou que ça reste incompris !
    Dernière modification par Htu ; 14/12/2012 à 16h51.

  26. #21
    maths33

    Re : ADN brin codant????

    Bonjour,

    Merci beaucoup d'avoir répondu ! Je suis rassurée parce que j'avais bien compris.

    Juste un petit truc pour l'histoire de la cystéine... On m'a donné un brin d'ADN sans informations est ce que je dois donc considérer que c'est le brin codant par convention ? On me demande combien de cystéines ça va donner en sachant la séquence ARN de la cystéine... J'aurais compté les séquences comme si c'était le transcrit mais apparemment c'est faux.

    Et aussi, j'ai cru comprendre que par convention le brin codant est 5'-3' mais est ce que c'est vraiment toujours le cas in vivo ? Sinon, est ce que c'est toujours le 5' qui code le NH2 de la protéine ?

    J'ai beaucoup de questions mais je pense que vous êtes les seules à pouvoir m'aider...
    Merci d'avance.

  27. #22
    Htu

    Re : ADN brin codant????

    Bonjour.

    Si on te donne un brin d'ADN, sans aucune information, et que le contexte de l'exercice concerne la transcription, c'est généralement le brin codant oui.
    Si non, tu auras l'orientation de tes brins, te permettant alors de savoir lequel est lequel (Codant ou transcrit).

    J'aurais compté les séquences comme si c'était le transcrit mais apparemment c'est faux.
    Il faut que tu comptes le nombre de séquence ADN de la cystéines dans le brin codant. Je t'explique pourquoi ceci fausse tes résultats :

    > On te demande combien de cystéines seront produites. ARN cystéine = UGU ou UGC.

    > UGU et UGC = TGT et TGC sur l'ADN (brin codant), mais sur le transcrit, c'est ACA et ACG (Ces 2 codons concernent la Thréonine.).

    D'où ton erreur de lire sur le brin transcrit/matrice.

    Et aussi, j'ai cru comprendre que par convention le brin codant est 5'-3' mais est ce que c'est vraiment toujours le cas in vivo ? Sinon, est ce que c'est toujours le 5' qui code le NH2 de la protéine ?
    Le brin codant est effectivement 5'-3', même in vivo. (Si tu as un OH à l'extrémité = 3' ; Groupement phosphate = 5'.)
    Si tu veux, dés qu'un gène a besoin d'être transcrit, l'ARN polymérase va se fixer sur le brin 3'-5' (matrice/transcrit) pour reproduire à l'identique le brin d'en face 5'-3' (brin codant) hors mis que les T seront des U.
    Donc si tu suis les étapes de transcription et traduction, tu auras bien le 5' qui se retrouvera traduit par le NH2 de la protéine. (Puisque l'ARN polymérase travaille de 5' en 3')

    En espérant t'avoir aidé au mieux.

    Bonne journée.
    Dernière modification par Htu ; 16/12/2012 à 11h39.

  28. #23
    maths33

    Re : ADN brin codant????

    C'est clair merci !

  29. #24
    MasteringType

    Lightbulb Re : ADN brin codant????

    Bonjour,j'ai refais l'exercice et je me demandais si il n'y avait pas une erreur, parce que je sais pas si j'ai bien compris...
    ARN à partir du brin transcrit : 5' AUUCCGCAUGCAUG 3' (Tu retrouves le brin codant avec des U remplaçant les T)
    Moi je trouve comme ARN à partir du brin transcrit : 5' AUUGGCGACUAC 3'
    Je sais que le sujet remonte à pas mal de temps, mais je suis tombé là dessus, et ça m'en a appris pas mal (je pense), tout est moins flou, mis à part les 5' et 3' que vous utilisez, je ne comprends pas tellement leur utilité (je pense avoir compris leur fonction : lire soit de gauche à droite (comme ARN polymérase 5' à 3') de de droite à gauche ( de 3' à 5')

    Je ne les ai jamais vu encore ces petit 3' et 5', je vais entrer en term S

    En tout cas ce passage est le must à connaitre :
    > Le brin transcrit est celui sur lequel va se fixer l'enzyme, et par conséquent, celui à partir duquel sera synthétisé l'ARN.

    > Le brin codant lui, aura la même séquence que l'ARN qui va être synthétisée. (Avec les T, non pas les U pour le brins codant)

  30. Publicité
  31. #25
    MasteringType

    Thumbs up Re : ADN brin codant????

    Je me permet de faire un up !!

  32. #26
    zebrafinche73

    Re : ADN brin codant????

    J'avoue rechercher plus de précision sur cette transcription d'ADN en ARN, dire que la lecture se fait dans le sens 3' vers 5' donnant un ARN 5'-3' me plait bien; cependant si on lit l'adn antiparallèle à l'envers, il devient aussi un brin 3'-5' !
    J'oublie quelque chose ou ???

    MERCI

  33. #27
    Yoyo

    Re : ADN brin codant????

    salut

    Eh oui les gènes peuvent être sur n'importe quel brin, du coup le brin qui est codant pour un gène peut être non codant pour un autre.

    Yoyo

Sur le même thème :

Discussions similaires

  1. [Biologie Moléculaire] brin sens / brin antisens
    Par mimismall dans le forum Biologie
    Réponses: 17
    Dernier message: 13/01/2013, 19h31
  2. [biochimie] ADN triple brin ?
    Par integrity_13 dans le forum Biologie
    Réponses: 4
    Dernier message: 10/07/2007, 15h29
  3. brin+ brin-?
    Par ccharly84 dans le forum Biologie
    Réponses: 3
    Dernier message: 17/04/2007, 08h08
  4. ADN non codant
    Par benjgru dans le forum Biologie
    Réponses: 9
    Dernier message: 16/04/2007, 23h56
  5. adn non codant
    Par leneo59 dans le forum Biologie
    Réponses: 0
    Dernier message: 06/01/2007, 17h43