Répondre à la discussion
Affichage des résultats 1 à 3 sur 3

insertion dans un phage



  1. #1
    XIII

    insertion dans un phage

    salut
    durant mes révisions j ai lu que lorsqu'on insère un fragment d' ADN etranger dans un phage il n'y a qu'une chance sur 6 d'obtenir ce qu'on désire
    il y a 2 possiblités à cause des 2 sens possibles d'orientation de l'ADN etranger (la je suis d accord)
    mais aussi 3 possiblités pour le cadre de lecture
    mais si on insère ladn normalement il n a qu 'un endroit possible pour se fixer par complémentarité non?
    vu qu'il ne peut se fixer que sur la séquence qui correspond parfaitement.
    je comprends pas trop
    merci de m 'expliquer

    -----


  2. #2
    Yoyo

    Re : insertion dans un phage

    Salut,

    Bon il manque pas mal d'infos mais je pense que tu parles de la technique de phage display qui permet de cribler des peptides grace a une librairie de phage.
    Alors pour les 6 possibilites.
    En effet le fragment d'ADNpeut se cloner dans les deux sens, et ensuite il peut se trouver dans n'importe laquelle des trois phases de lecture. Donc en effet ca fait 6 possibilites:
    . mais qu'est-ce que ca veut dire?

    Ce qu'il ne faut pas perdre de vue est que tu cherches a faire une protéine de fusion il est donc obligatoire que le fragment d'ADN que tu clones soit dans la bonne pahse de lecture par rapport au gene de la protéin auquel tu le fusionnes.
    Comme cet ADN est obtenue par des cassures aléatoires, il peut etre cassé a n'importe quelle positions.

    Un petit exemple:
    La séquence suivante (ADNg).
    ATGCCGTACGAAGTGGCTAAAACAGCAATA GCTAGCAGTCGCCGCCTG

    cassons cet ADN (une cassure par molécule): (symbolisé par ^)
    ATGCCGTAC^GA^AGTGG^CTAAAACAGCA ATAGCTAGCAGTCGCCGCCTG
    on a donc une solution qui contiendra notamment les fragments suivants:

    1. GAAGTGGCTAAAACAGCAATAGCTAGCAGT CGCCGCCTG
    2. AGTGGCTAAAACAGCAATAGCTAGCAGTCG CCGCCTG
    3. CTAAAACAGCAATAGCTAGCAGTCGCCGCC TG
    Ces fragmenst sont fusionnés a un gene de la maniere suivante:

    Le gene:
    ATG-NNN-NNN-NNN-(le fragment)-TAA
    Tu vois bien que si la bonne pahse de lecture (qui est la premiere) n'est pas en phase avec le gene alors la protéine ne s'exprimera pas.

    Selon les trois phase tu obtiendras les protéines suivantes (en aa), la lecture debute au codon ATG du gene du phage:

    1. EVAKTAIASSRRL
    2. SG*NSNS*QSPP (les * representent des codons stop)
    3. LKQQ*LAVAA

    Tu vois bien que selon la phase de lecture les polypeptides obtenus sont totalement differents, seul le 1 t'interesse a priori.


    Yoyo
    Dernière modification par Yoyo ; 14/05/2005 à 17h28.

  3. #3
    XIII

    Re : insertion dans un phage

    merci beaucoup
    en effet c est plus clair comme ca...

Discussions similaires

  1. Insertion d'image dans un document LaTeX
    Par olle dans le forum Logiciel - Software - Open Source
    Réponses: 14
    Dernier message: 27/05/2012, 14h17
  2. [Blanc] insertion d'eau dans la machine à laver
    Par papa schtroumpf dans le forum Dépannage
    Réponses: 5
    Dernier message: 15/11/2007, 13h06
  3. insertion d'une image dans une document lateX
    Par milsabor dans le forum Logiciel - Software - Open Source
    Réponses: 19
    Dernier message: 15/08/2007, 22h45
  4. insertion image dans réponse automatique
    Par ^don dans le forum Internet - Réseau - Sécurité générale
    Réponses: 0
    Dernier message: 23/12/2006, 15h41
  5. Recombinaison chez le phage lambda
    Par Lau dans le forum Biologie
    Réponses: 0
    Dernier message: 06/08/2005, 15h50