Répondre à la discussion
Affichage des résultats 1 à 12 sur 12

DNA polymérase




  1. #1
    Grendel26

    DNA polymérase

    Bonjour, j'avais une question peut-être naïve mais:

    Admettons que l'on ait la séquence suivante avec une amorce:

    5'TTTGACAGACTT3'
    3'AAACTGTCTGAATGCTAGATCGGTTG5'

    Maintenant, dans la solution l'on ne met que les nucléotides suivantes: dATP, dGTP et pas les 2 autres.
    La polymérase va-t-elle continuer en créant des gap ou va-t-elle s'arrêter à la seconde près ou elle ne pourra pas rajouter une dnucléotide vu qu'elle ne sera pas présente?

    J'avais une autre question, lorsqu'on ajoute de l'ATP en solution, c'est bien pour accélérer l'activité de la polymérase right?

    Merci beaucoup.

    -----

    Biology is not a quiet river.

  2. Publicité
  3. #2
    Meiosis

    Re : DNA polymérase

    Bonjour,

    Elle s'arrête car elle n'aura plus d'extrémité 3' pour mettre le nucléotide suivant. D'ailleurs on utilise ce principe dans le séquençage de Sanger, on met des ddNTP (dépourvus d'extrémité 3') pour arrêter la synthèse d'un brin dès qu'un ddNTP est incorporé.

  4. #3
    Grendel26

    Re : DNA polymérase

    Ah oui, vu comme ça c'est plutôt logique.
    Merci beaucoup !
    Biology is not a quiet river.


  5. #4
    Grendel26

    Re : DNA polymérase

    Et du coup, ajouter de l'ATP dans la solution, ca augmente l’efficacité ou vitesse de l'enzyme polymérase?
    Biology is not a quiet river.

  6. #5
    Meiosis

    Re : DNA polymérase

    Je ne sais pas, quelqu'un d'autre pourra sans doute te répondre.

  7. A voir en vidéo sur Futura
  8. #6
    Flyingbike

    Re : DNA polymérase

    ben c'est surtout indispensable, puisque l'enzyme fonctionne avec des nucléotides triphosphates...
    La vie trouve toujours un chemin

  9. #7
    Meiosis

    Re : DNA polymérase

    Citation Envoyé par Flyingbike Voir le message
    ben c'est surtout indispensable, puisque l'enzyme fonctionne avec des nucléotides triphosphates...
    Mais pour l'ADN polymérase il faut du dATP et pas de l'ATP (ce serait pour l'ARN). Non ?

  10. Publicité
  11. #8
    Flyingbike

    Re : DNA polymérase

    oui right, mauvaise habitude parce qu'on ne dit pas toujours le "d" de "dATP"

    L'ATP (le ribonucléotide) je dirais que ça aurait plutôt tendance a l'emmerder, la DNA polymérase...
    La vie trouve toujours un chemin

  12. #9
    Grendel26

    Re : DNA polymérase

    Enfaite, voici la question, j'ai tout compris sauf pourquoi ils insistent avec l'ATP ^^

    Capture.PNG
    Biology is not a quiet river.

  13. #10
    Flyingbike

    Re : DNA polymérase

    la question 3 ?
    ben vous connaissez la différence, déjà, non ? qu'est ce qui vous pose problème ?
    La vie trouve toujours un chemin

  14. #11
    Grendel26

    Re : DNA polymérase

    Oui oui, c'est pour la dernière, citer des exemples d'utilisation en biologie moléculaire?
    Nous savons à quoi sert l'ATP mais s'en servir en labo c'est tout autre chose...
    Biology is not a quiet river.

  15. #12
    Flyingbike

    Re : DNA polymérase

    Par exemple pour la transcription in vitro, pour la ligation de l'ADN, pour des réactions de phosphorylatuon, etc
    La vie trouve toujours un chemin

Discussions similaires

  1. [Biologie Moléculaire] Taq DNA polymerase et Go taq DNA polymerase
    Par katakyt dans le forum Biologie
    Réponses: 8
    Dernier message: 08/05/2017, 18h11
  2. [Biologie Cellulaire] ADN Polymérase/ ARN polymérase
    Par yassirlek dans le forum Biologie
    Réponses: 0
    Dernier message: 31/03/2013, 21h12
  3. Adm polymérase 3
    Par missmarwa10 dans le forum Biologie
    Réponses: 1
    Dernier message: 21/09/2012, 23h57
  4. [Biologie Moléculaire] Différences entre : E.coli DNA Polymerase I / T4 DNA Polymerase
    Par Louts30 dans le forum Biologie
    Réponses: 1
    Dernier message: 05/02/2012, 00h57
  5. [Génétique] ADN polymérase
    Par Sozory dans le forum Biologie
    Réponses: 2
    Dernier message: 18/12/2010, 01h27