Répondre à la discussion
Affichage des résultats 1 à 12 sur 12

Besoin d'aide en biochimie



  1. #1
    lola74

    Besoin d'aide en biochimie

    Bonjour à tous !

    J'ai besoin d'une grande aide, je dois rendre ce devoir demain et j'ai beau relire mon cours j'ai beaucoup de mal à répondre...
    On me demande de donner le gène correspondant à :
    5' 3'
    123 CUAUAUCCAGGACGAUAAAAA


    On me demande également de dire à quoi correspond le "123"

    Merci d'avance

    Lola

    -----


  2. Publicité
  3. #2
    piwi

    Re : URGENT : Besoin d'aide en biochimie

    Pourriez vous nous donner la question exacte qui vous est posée? J'ai peur que vous ne la compreniez pas. En effet la question telle que vous la présentez semble curieuse et surtout totalement dénuée de tout interet pour un étudiant.
    Pour le 123 il correspond probablement à la postition du premier C dans la séquence de l'ARN

    Cordialement,
    piwi

  4. #3
    lola74

    Re : URGENT : Besoin d'aide en biochimie

    Je dois représenter le gène qui correspond à ce que j'ai écrit

  5. #4
    Effie

    Re : URGENT : Besoin d'aide en biochimie

    Pose toi la question: que représente ce que j'ai écrit (ADN, ARN, polypeptide......)? Tu te demanderas ensuite quelle étape correspond au passage du gène à "ça", quelles en sont les modalités..... et tu retrouveras ton gène.

  6. #5
    lola74

    Re : URGENT : Besoin d'aide en biochimie

    Si je ne me trompe pas il s'agit de l'ARN, mais je suis bloquée là
    J'ai beaucoup de lacunes dans cette matière malheureusement...

  7. A voir en vidéo sur Futura
  8. #6
    luciole.d.bois

    Smile Re : URGENT : Besoin d'aide en biochimie

    Salut ,
    Alors voici la solution à ton exercice :
    Tu as une séquence d'ARN qui code donc pour une protéine de séquence en acides aminés (ADN--->ARN(transcription)--->Protéine(traduction, ribosome)) A partir du moment ou tu as des Uraciles dans ta séquence c'est de l'ARN dans l'ADN il n'y en a pas.
    Cela donne selon le code génétique http://fr.wikipedia.org/wiki/Code_g%C3%A9n%C3%A9tique: (que tu as du avoir en cours aussi)

    CUA----> Leucine
    UAU----> Tyrosine
    CCA-----> Proline
    GGA-----> Glycine
    CGA-----> Arginine
    UAA est le codon stop pour la traduction.
    AAA est certainement la queue poly A

    voila, pour le 123 je pense que c'est pour marquer le N ter de la protéine ou du peptide
    Bisous j'espère que ca va comme réponse bon courage bosse bien
    Luciole

  9. Publicité
  10. #7
    lola74

    Re : URGENT : Besoin d'aide en biochimie

    Merci beaucoup de ta réponse
    J'ai regarder de mon côté aussi par contre pour le AAA j'ai trouvé que cela correspondait au "Lys" est ce que c'est possible?
    Encore merci

  11. #8
    luciole.d.bois

    Re : URGENT : Besoin d'aide en biochimie

    Oui c'est possible que cela soit une lysine.

  12. #9
    piwi

    Re : URGENT : Besoin d'aide en biochimie

    Ou les codes de la biochimie ont changé ou c'est moi qui ne comprends rien mais je ne vois pas en quoi le fait de donner un polypeptide vous donner le gène codé par le fragment d'ARN.
    La question peut être: donner la sequence d'ADN codant pour le fragment d'ARN suivant. Dans ce cas là, on n'attend pas du tout une sequence peptidique.

    Il s'agit probablement de retranscrire la séquence ARN en ADN, ce qui ne pose pas de réelle difficulté. Maintenant y a t-il des pièges?
    Une queue polyA? Possible, mais on en a pas long, difficile de juger. En tout état de cause elle est supposée se trouver après un codon stop. Mais celui que l'on voit est il dans le cadre de lecture? (en un mot est ce réellement un codon stop?) Et de plus la queue polyA ne vient pas immédiatement après un codon stop. Donc si celui que vous voyez est bien dans le cadre de lecture je doute que ce que vous voyez juste derrière soit de la queue polyA et j'aurai plutot tendance à penser que c'est aussi de la séquence transcrite. Dans tous les cas de figures il me semble donc peu probable que ce polyA soit la queue polyA d'un ARNm.
    D'une façon qui vous dépasse peut être mais qu'il est interessante de souligner ici, la queue polyA n'est pas ajoutée comme cela à la fin d'un ARNm. On trouve à environ 15 nucléotides en amont du site d'ajout de la queue une sequence consensus (je doute qu'elle soit toujours parfaitement conservée) AAUAAA qui va permettre de positionner les enzymes responsable de la mise en place du polyA. Ca n'est à priori pas le cas.

    Comment savoir si le codon stop est dans le cadre de lecture? (si vous y tenez vraiment) Vous savez que le premier C de votre séquence est en position 123. Ce qui le place comme le dernier acide aminé du 41ème codon de votre séquence.
    123 CUAUAUCCAGGACGAUAAAAA
    Conclusion: le codon stop que vous observez n'est pas dans le cadre de lecture.

    Cordialement,
    piwi

  13. #10
    lola74

    Re : URGENT : Besoin d'aide en biochimie

    Merci de votre aide, je vais encore travailler un peu plus en profondeur sur ce devoir...

    Cordialement

    Lola

  14. #11
    Znomjo

    Re : URGENT : Besoin d'aide en biochimie

    Salut, est-ce que le numéro 123 ne voudrait-il pas dire plutôt que l'on ignore la phase de lecture? Il me semble avoir déjà vu ça... Sinon il semblerait logique qu'il s'agisse effectivement de la position du premier nucléotide.

  15. #12
    Effie

    Re : URGENT : Besoin d'aide en biochimie

    Je rejoins Piwi: on ne demande pas un séquence en acides aminés mais la séquence du gène, donc l'ADN.
    Lola74, c'est en effet de l'ARN (présence de U, que l'on ne retrouve pas dans l'ADN).
    L'étape qui permet de passer de l'ADN à l'ARN est la transcription; elle se fait par complémentarité des bases (G est placé face à C, ....). 123 doit être la numérotation du premier nucléotide que l'on te donne.
    A partir de là, il n'est pas difficile de définir la séquence d'ADN que l'on te demande!

  16. Publicité

Sur le même thème :

Discussions similaires

  1. besoin d'un correcteur et besoin d'aide
    Par cactus3 dans le forum Mathématiques du collège et du lycée
    Réponses: 8
    Dernier message: 16/12/2007, 19h00
  2. Besoin d'aide, beaucoup d'aide...
    Par abdelrahmane dans le forum TPE / TIPE et autres travaux
    Réponses: 3
    Dernier message: 30/11/2007, 13h20
  3. débouchés biochimie et SDV parcours biochimie??
    Par rmaria dans le forum Orientation après le BAC
    Réponses: 2
    Dernier message: 02/03/2006, 18h25
  4. débouchés biochimie et SDV parcours biochimie, la meme chose??
    Par rmaria dans le forum Orientation après le BAC
    Réponses: 0
    Dernier message: 02/03/2006, 16h29
  5. Réponses: 0
    Dernier message: 04/12/2004, 13h02