Répondre à la discussion
Affichage des résultats 1 à 6 sur 6

Brin transcrit



  1. #1
    amandinedu13

    Angry Brin transcrit


    ------

    Bonjour,
    J'ai un DM à rebdre en SVT mais je bloque sur la première question.
    Enoncé:
    Soit une protéine humaine composée de 302 acides aminés. On a isolé un fragmant d'ADN contenant le début de la phase codante du gène correspondant :
    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAACG
    CCATACTAGGACCTTTGGATTGCTACATTG AAGAGCCGTCGATCCGTATTGC

    1)Identifiez le début de la phrase codante du gène.
    Quel est le brin transcrit.

    Je ne comprend pas car dans le 2 brins il y a un codon-stop.
    Merci d'avance;

    -----

  2. Publicité
  3. #2
    Znomjo

    Re : Brin transcrit

    Salut, les codons stop ne posent problème que si ils sont dans la même phase de lecture que ton codon start, cela ne semble pas être le cas pour le brin du dessous.

  4. #3
    jmbowie

    Re : Brin transcrit

    Il y a en tout 2 x 3 cadres de lecture à regarder (3 cadres par brin). Le ou les cadres qui ne contiennent pas de codon STOP (TAA, TAG, TGA) sont probablement les bons (car il s'agit que du DEBUT de la séquence du gène).
    Le brin transcrit est celui sur lequel il n'y a pas de codon STOP dans le cadre que tu auras déterminé.

  5. #4
    amandinedu13

    Re : Brin transcrit

    Merci Znomjio et Jmbowie. Quels sont les codons start?

  6. #5
    jmbowie

    Re : Brin transcrit

    Citation Envoyé par amandinedu13 Voir le message
    Merci Znomjio et Jmbowie. Quels sont les codons start?
    Classiquement, le codon START est ATG. Mais TTG, GTG et CTG sont utilisés parfois (plus rarement et avec une efficacité moindre).

  7. A voir en vidéo sur Futura
  8. #6
    Yoyo

    Re : Brin transcrit

    Citation Envoyé par amandinedu13 Voir le message
    Merci Znomjio et Jmbowie. Quels sont les codons start?
    Dis avant de venir poser des questions sur le forum, il serait souhaitable que tu lises ton cours! Tu as forcément vu les codon start et stop sinon ton prof ne te poserait meme pas cet exercice!

    Yoyo

  9. Publicité

Sur le même thème :

Discussions similaires

  1. [Biologie Moléculaire] brin sens / brin antisens
    Par mimismall dans le forum Biologie
    Réponses: 17
    Dernier message: 13/01/2013, 20h31
  2. brin+ brin-?
    Par ccharly84 dans le forum Biologie
    Réponses: 3
    Dernier message: 17/04/2007, 09h08
  3. réplication du brin sens
    Par zéphyr86 dans le forum Biologie
    Réponses: 2
    Dernier message: 08/04/2007, 23h58
  4. Brin non-transcrit
    Par Annyah dans le forum Biologie
    Réponses: 1
    Dernier message: 08/02/2007, 17h38
  5. repérer le brin transcrit
    Par snyfir dans le forum Biologie
    Réponses: 13
    Dernier message: 07/11/2005, 22h35