Répondre à la discussion
Affichage des résultats 1 à 14 sur 14

repérer le brin transcrit



  1. #1
    snyfir

    Question repérer le brin transcrit

    Bonjour,

    j'ai un exercice et je suis bloqué a une question. J'ai un fragment d'ADN:
    1 AATGCACGCGGGTATGAATAGATTAATTAC CGTTTGAT
    2 TTACGTGCGCCCATACTTATCTAATTAATG GCAAACTA

    Et j'ai une question qui me demande de repérer le brin transcrit de de cette molécule l'ADN, mais je ne c'est pas du tou comment m'y prendre. Si quelqu'un peut m'éclairer. Merci beaucoup.

    -----


  2. Publicité
  3. #2
    ananda

    Re : repérer le brin transcrit

    Salut,

    Si j'ai bien compris ton problème :

    Le brin transcrit est le brin codant, possèdant à un endroit une phase ouverte de lecture (ORF) Si tu observes le brin 1 :

    AATGCACGCGGGTATGAATAGATTAATTAC CGTTTGAT

    Y'a un codon ATG et plus loin, un codon stop (TGA) (la protéine codée étant MHAGMNRLITV

    Si tu observes le brin 2 : y'a pas d'ORF notables (y'en a deux mais qui partes en sens inverse)

    A+

  4. #3
    snyfir

    Re : repérer le brin transcrit

    Merci beaucoup pour la réponsse. Je comprend pas quand vous dite : "(la protéine codée étant MHAGMNRLITV" Comment tu c'est que ces MHAGMNRLITV ?

    Il ya une autre question aussi que je comprend pas c'est : repérez la séquence du gène porté par cet ADN, codant pour un polypeptide que nous limiterons à 10 acides aminés.
    Et c'est quoi un polypeptide ?

    merci d'avance

  5. #4
    ananda

    Re : repérer le brin transcrit

    Pour la séquence MHAGMNRLITV, je me base tout simplement sur le code génétique : ATG=M, etc. Un polypeptide, c'est une succession d'acides aminés formant une molécule. Un polypeptide, c'est une protéine ! (j'ai jamais compris la subtilité de signification entre polypeptide et protéine, mais c'est kif-kif "à l'usage").

  6. #5
    snyfir

    Re : repérer le brin transcrit

    OK merci beaucoup. Et avez vous une idés sur la question : repérez la séquence du gène porté par cet ADN, codant pour un polypeptide que nous limiterons à 10 acides aminés.

  7. A voir en vidéo sur Futura
  8. #6
    Yoyo

    Re : repérer le brin transcrit

    Bonjour

    Désolé mais il y a une petite erreur dans ce qu'a ecrit ananda. le brin transcrit n'est pas le brin 1 mais le brin 2!

    Car apres transcription il faut que l'ARNm permette de coder la protéine. Or seul le brin 2 permet par complémentarité d'obtenir un ARNm identique (aux T pres) au brin 1.

    Pour ta deuxieme question snyfir, ananda ta répondu en te donnant la sequence de ta protéine (elle t'a meme donné 11 acide amines ).

    Yoyo

  9. Publicité
  10. #7
    ananda

    Re : repérer le brin transcrit

    Shame on me ! A ma décharge, il y a un "certain" imbroglio sur la dénomination brin transcrit/codant/lu/non lu...Par contre, le brin codant est bien le 1.

    A+

    PS : ananda, ce n'est pas amanda. Chui un mec ! (vive le pseudo raté-ambigu )

    EDIT: pour que ça soit clair. Brin transcrit : brin qui sert de matrice, dont la séquence est complémentaire à celle de l'ARNm (excepté la modif T<->U). Brin codant : brin de séquence complémentaire au brin transcrit, c'est à dire de même séquence que l'ARNm (excepté la modif T<->U). Au final, l'ARNm est pris en charge, entre autre, par nos amis les ribosomes et c'est parti pour la traduction (voir le code génétique)
    Dernière modification par ananda ; 07/11/2005 à 14h21.

  11. #8
    snyfir

    Re : repérer le brin transcrit

    AATGCACGCGGGTATGAATAGATTAATTAC CGTTTGAT

    IL y a quelque chose que je ne comprend pas : ATG est le codon initiateur et TGA est le codon stop, mais tu prends le deusième TGA et non celui qui arrive aprais le ATG (celui que j'ai souligné).

  12. #9
    snyfir

    Re : repérer le brin transcrit

    "Pour ta deuxieme question snyfir, ananda ta répondu en te donnant la sequence de ta protéine (elle t'a meme donné 11 acide amines "

    sa ne peut pas etre sa car ma 3eme question est de déterminer la séquence de Arnm.
    et la 4eme question est de donner la sequence du polypepdite. Donc c pluto la réponsse de la 4eme question. Donc si quelqu'un a une idé de ce que veut dir la qestion 2: repérez la séquence du gène porté par cet ADN, codant pour un polypeptide que nous limiterons à 10 acides aminés.

  13. #10
    ananda

    Re : repérer le brin transcrit

    C'est une question de phase de lecture : à partir de l'ATG, tu prends les codons "3 par 3" (par définition).

    En clair (les codons sont soulignés)

    A ATG CAC GCG GGT ATG AAT.....


    Tu vois que, dans le cadre de lecture défini par l'ATG, le codon stop TGA que tu as répéré "n'est pas lu" comme TGA, mais comme ATG et AAT

    Donc : ce n'est pas parceque tu vois dans une séquence 3 nucléotides successifs correspondant à un potentiel codon stop qu'il s'agit effectivement d'un codon stop. Tout dépend de la phase de lecture. (typiquement dans la séquence d'un gène codant une protéine, il y a plusieurs codons stop "potentiels", mais "potentiels uniquement", parcequ'ils ne seront pas lus comme tels). Tu as déjà eu des cours avant cet exercice, non ?

    A+
    Dernière modification par ananda ; 07/11/2005 à 17h15.

  14. #11
    ananda

    Re : repérer le brin transcrit

    Citation Envoyé par snyfir
    "Pour ta deuxieme question snyfir, ananda ta répondu en te donnant la sequence de ta protéine (elle t'a meme donné 11 acide amines "

    sa ne peut pas etre sa car ma 3eme question est de déterminer la séquence de Arnm.
    et la 4eme question est de donner la sequence du polypepdite. Donc c pluto la réponsse de la 4eme question. Donc si quelqu'un a une idé de ce que veut dir la qestion 2: repérez la séquence du gène porté par cet ADN, codant pour un polypeptide que nous limiterons à 10 acides aminés.
    Je pense que tu as largement les données nécessaires pour répondre à ta seconde question.

  15. #12
    Yoyo

    Re : repérer le brin transcrit

    Désolé ananda pour la confusion mais faut pas choisir un tel pseudo aussi qu'elle idée!!!!
    Citation Envoyé par ananda
    Je pense que tu as largement les données nécessaires pour répondre à ta seconde question.
    Je suis bien d'accord, on va pas non plus te faire tout l'excercice a ta place

    YOyo

  16. Publicité
  17. #13
    snyfir

    Re : repérer le brin transcrit

    Merci beaucoup pour vaux réponsses par contre si : "Brin transcrit : brin qui sert de matrice, dont la séquence est complémentaire à celle de l'ARNm" alor c'est le brin 2 qui est transcrit de l'exercice est non le brin 1

    Edit: J'avais mal lu le message de Yoyo.

    Merci pour votre aide sa ma permi de bien comprendre mon DM.
    Dernière modification par snyfir ; 07/11/2005 à 19h34.

  18. #14
    gechan

    Re : repérer le brin transcrit

    Citation Envoyé par snyfir
    Merci beaucoup pour vaux réponsses par contre si : "Brin transcrit : brin qui sert de matrice, dont la séquence est complémentaire à celle de l'ARNm" alor c'est le brin 2 qui est transcrit de l'exercice est non le brin 1
    C'est ça !! il te suffit de remplacer le T par U sur le brin 1 pour avoir la séquence ARN complémentaire du brin 2.

Sur le même thème :

Discussions similaires

  1. [Biologie Moléculaire] brin sens / brin antisens
    Par mimismall dans le forum Biologie
    Réponses: 17
    Dernier message: 13/01/2013, 19h31
  2. [Génétique] Brin transcrit
    Par amandinedu13 dans le forum Biologie
    Réponses: 5
    Dernier message: 20/10/2007, 20h11
  3. [Divers] HELP reperer un composant H.S
    Par BIG-BILL dans le forum Dépannage
    Réponses: 5
    Dernier message: 23/04/2007, 20h50
  4. brin+ brin-?
    Par ccharly84 dans le forum Biologie
    Réponses: 3
    Dernier message: 17/04/2007, 08h08
  5. Brin non-transcrit
    Par Annyah dans le forum Biologie
    Réponses: 1
    Dernier message: 08/02/2007, 16h38