Répondre à la discussion
Affichage des résultats 1 à 8 sur 8

Adn



  1. #1
    linnou

    Red face Adn


    ------

    Bonsoir,
    J'aurais besoin de votre aide svp.

    1- Comment l'ADN est capable de détenir une information? Sous quelle forme peut être stoké un message génétique dans l'ADN?

    2- Qu'est ce que c'est une séquence de nucléotide ? C'est des nucléotides d'une même chaine qui se suivent ou c'est des nucléotides complémentaires (A avec T et C avec G) qui se suivent des deux chaines qui constituent l'ADN?

    3-
    ttcagttgtgaatgaatggacgtgccaaat agacgtgccgccgccgctcgattcgcactt
    Les nucléotides s'associent deux à deux, pourquoi ici les couples de nucléotides ne se suivent pas c'est à dire pourquoi il n'y pas écris par exemple TACGTATACG ?

    4- Si on fait une mutation sur une séquence de nucléotide d'une chaine, il y a forcement une autre mutation sur l'autre séquence de nucléotide de l'autre chaine, étant donné que les nucléotides sont complementaires ?

    Les questions doivent être formulé bizarrement mais c'est parce que c'est flou dans ma tête, aidez moi s'il vous plait.

    Sur ce, bonne fin de week-end et merci d'avance.

    -----

  2. Publicité
  3. #2
    Guillaume69

    Re : Adn

    Bonsoir,

    Citation Envoyé par linnou Voir le message
    Bonsoir,
    J'aurais besoin de votre aide svp.

    1- Comment l'ADN est capable de détenir une information? Sous quelle forme peut être stoké un message génétique dans l'ADN?
    Sous la forme de la succession de nucléotides dont la base azotée (A, T, C ou G) constitue la partie variable, donc l'information. Il s'agit donc d'une information codée par un alphabet à 4 lettres, et qui, par l'intérmédiaire du code génétique, sera traduit en un alphabet à une vingtaine de lettre : les acides aminés des protéines.

    Lire les articles wikipédia d'ADN, de transcription, de traduction, de code génétique.

    2- Qu'est ce que c'est une séquence de nucléotide ? C'est des nucléotides d'une même chaine qui se suivent ou c'est des nucléotides complémentaires (A avec T et C avec G) qui se suivent des deux chaines qui constituent l'ADN?
    Une séquence est une succession ordonnée.
    Une séquence de nucléotide est donc une succession ordonée de nucléotides sur un même brin (on parle de brin, pas de chaîne).

    3-
    ttcagttgtgaatgaatggacgtgccaaat agacgtgccgccgccgctcgattcgcactt
    Les nucléotides s'associent deux à deux, pourquoi ici les couples de nucléotides ne se suivent pas c'est à dire pourquoi il n'y pas écris par exemple TACGTATACG ?
    Cela découle de la réponse précédente. Les nucléotides s'associent deux entre deux brins complémentaires (http://fr.wikipedia.org/wiki/Compl%C...s_azot%C3%A9es), et non de manière successive sur un même brin.
    Si tu as un T à une position donnée, tu auras forcément un A 'en face', sur le brin complémentaire. Mais juste avant ou juste après, tu peux avoir n'importe quel nucléotide.

    4- Si on fait une mutation sur une séquence de nucléotide d'une chaine, il y a forcement une autre mutation sur l'autre séquence de nucléotide de l'autre chaine, étant donné que les nucléotides sont complementaires ?
    oui.
    Pour simplifier, lors de la réplication, le nucléotide muté verra son complémentaire être incorporé, de sorte que le nouveau brin synthétisé sera muté également.

    Mais il existe des systèmes de réparation.

    @+
    Dernière modification par Guillaume69 ; 13/11/2011 à 17h37.

  4. #3
    linnou

    Re : Adn

    Ok, je vous remercie, c'est déjà plus clair dans ma tête
    Mais juste une dernière question:
    Lorsqu'on fait une mutation, l'allèle muté disparaît ou c'est un nouveau allèle qui se crée?
    Si c'est un nouveau où il est placé étant donné que chaque géne a seulement deux alléle situés sur des chromosome homologues au même endroit ?

  5. #4
    kamor

    Re : Adn

    Si vous faites une mutation, l'allèle muté reste "là où il est".
    Oui c'est un nouveau dans le sens où la séquence a été changé. Un allèle ne disparaitra pas, à la rigueur la mutation peut amener à la mort de la cellule.
    Vous modifiez la séquence donc elle remplace l'ancienne.

  6. #5
    linnou

    Re : Adn

    Merci de votre intervention.

    Et quand on parle de gène est-ce la succession des nucléotides d'un même brin ou la succesion des nucléotides complémentaires des deux chaines ?

    Merci d'avance,
    Bonne journée.

  7. A voir en vidéo sur Futura
  8. #6
    Baptiste10

    Re : Adn

    Oui, c'est uniquement la succession des nucléotides d'un seul brin car l'autre brin bien qu'il soit complémentaire sera inversé (on parle de reverse complement) et donnera une autre information génétique (ARNm différent, donc protéine différente par exemple).

  9. Publicité
  10. #7
    linnou

    Re : Adn

    Bonsoir
    Citation Envoyé par Guillaume69 Voir le message

    oui.
    Pour simplifier, lors de la réplication, le nucléotide muté verra son complémentaire être incorporé, de sorte que le nouveau brin synthétisé sera muté également.
    1-Donc c'est le nucléotide complémentaire à celui qui est muté qui est modifié? Que désigne alors le mismatch repair ?

    2- "Oui, c'est uniquement la succession des nucléotides d'un seul brin car l'autre brin bien qu'il soit complémentaire sera inversé (on parle de reverse complement) et donnera une autre information génétique (ARNm différent, donc protéine différente par exemple).
    Donc si j'ai bien compris les deux séquences de nucléotides des deux brins n'ont rien en commun mis à part qu'ils sont complémentaires?

    Merci à ceux qui pourront m'aider.
    Dernière modification par linnou ; 15/11/2011 à 19h03.

  11. #8
    Baptiste10

    Re : Adn

    Bonsoir,

    1- Oui c'est le nucléotide complémentaire à celui qui est muté qui va changer lors de la réplication. Concernant le mismatch repaire, c'est une mécanisme de surveillance de l'ADN : en fait lors de la réplication, il arrive parfois que l'ADN polymerase se trompe en recopiant un brin d'ADN (on parle d'ADN matrice), par exemple en face d'un A au lieu de mettre un T elle met un C. Du coup tu te retrouve avec un ADN double brin avec une paire de base non complémentaire, A et C dans l'exemple (on parle de mismatch). Du coup le mécanisme de mismatch repair permet d'éliminer la portion du nouveau brin nouvellement synthétisé qui contient l'erreur. Ensuite, l'ADN polymerase revient recopier le brin matrice de cette portion sans se tromper cette fois. Du coup ça permet de ne pas transmettre la mutation au cellules descendantes et de conservé l'information génétique initiale

    2-Oui sauf pour les séquences palindromiques!

Sur le même thème :

Discussions similaires

  1. [Génétique] hybridation adn/adn : technique de southern blot
    Par sassou971 dans le forum Biologie
    Réponses: 4
    Dernier message: 01/11/2011, 21h28
  2. [Biochimie] Différence entre puce à ADN et sonde à ADN !
    Par cysto dans le forum Biologie
    Réponses: 1
    Dernier message: 06/04/2011, 02h27
  3. [Pré-BAC] Différence entre puce ADN et banque ADN
    Par Haggard dans le forum Exercices en biologie
    Réponses: 2
    Dernier message: 13/10/2009, 12h17
  4. [Génétique] ADN humain et ADN végétal
    Par scvie dans le forum Biologie
    Réponses: 4
    Dernier message: 01/01/2008, 14h52
  5. [Biologie Moléculaire] l'hybridation ADN/ADN "les différent méthodes???"
    Par Hamza2lh dans le forum Biologie
    Réponses: 3
    Dernier message: 07/11/2007, 10h18