Répondre à la discussion
Affichage des résultats 1 à 3 sur 3

question de qPCR pratique avec exemple



  1. #1
    neurolinc

    question de qPCR pratique avec exemple


    ------

    Bonjour à tous !

    j'ai cherché un peu partout sur les forums concernant le choix des amorces de qPCR et je ne trouve pas ma réponse.
    je sais que le pourcentage de GC doit être le plus élevé possible (pour la spécifité ) mais je ne sais pas ce qu'il en est concernat la distance des amorces: (pour sybergreen)
    -les deux amorces doivent elles etre les plus éloignées possible ? ou les plus proches possible ? (pour eviter la contamination avec l'ADNg ???)
    je vous joins 3 couples d'amorces si vous pouvez m'expliquer pourquoi vous choisiriez l'une ou l'autresimplement ce serait super ! merci beaucoup

    Primer Information

    Gene Name: Gcg RefSeq ID: NM_008100 Chromosome: chr2 Strand: -

    Transcription: 62422289-62413166 Number of introns: 5

    Right primer sequence: TGCCTTGCACCAGCATTAT Position: 152 Length: 19 GC%: 47.368 Tm: 60.235

    Left primer sequence: TGTCTACACCTGTTCGCAGC Position: 55 Length: 20 GC%: 55 Tm: 60.056

    cDNA amplicon size:98 Estimated genomic amplicon size:3095 in silico PCR

    Right primer sequence: TCCTCTGTGTCTTGAAGGGC Position: 183 Length: 20 GC%: 55 Tm: 60.386

    Left primer sequence: TGTCTACACCTGTTCGCAGC Position: 55 Length: 20 GC%: 55 Tm: 60.056

    cDNA amplicon size:129 Estimated genomic amplicon size:3126 in silico PCR

    Right primer sequence: TGGGGTTCTCCTCTGTGTCT Position: 191 Length: 20 GC%: 55 Tm: 59.682

    Left primer sequence: TGTCTACACCTGTTCGCAGC Position: 55 Length: 20 GC%: 55 Tm: 60.056

    cDNA amplicon size:137 Estimated genomic amplicon size:3134 in silico PCR

    -----

  2. #2
    Annaick_R

    Re : question de qPCR pratique avec exemple

    Bonjour,

    un petit truc en + : il faut essayer de finir par 3 G/C (CGG, GCG,CCC,etc.) pour améliorer l'accroche de l'amorce en 3' et facliter le démarrage de la PCR.

    Ensuite, si tu es en real-time qPCR, il est conseillé d'avoir un amplicon court 100-200 pb pour être sûr de répliquer l'ensemble de la séquence à chaque cycle de PCR.

    Le pourcentage de GC n'a rien à voir avec la spécificité, il sert à obtenir un Tm élevé. En effet, tu peux avoir 2 séquences proches (gènes orthologues) avec un fort pourcentage de GC.
    Pour vérifier la spécificité des amorces, il faut savoir s'il existe d'autres gènes ayant une séquence proche du tien avec BLAST et vérifier que tu n'as pas positionné ton amorce dans des zones conservées (i.e. qui présente un fort pourcentage d'identité). Je crois même que maintenant qu'il existe un programme BLAST spécial pour tester directement ton amorce contre l'ensemble du génome.

    Il faut également vérifier que tes amorces ne se replient pas en épingle à cheveux (ou hairpin) grâce à des logiciels spécialisés. Il y en a sûrement en ligne.

    Bonne continuation

  3. #3
    neurolinc

    Re : question de qPCR pratique avec exemple

    merci pour votre réponse, mais ma question était surtout
    -les deux amorces doivent elles etre les plus éloignées possible ? ou les plus proches possible ? (pour eviter la contamination avec l'ADNg ???)
    je vous joins 3 couples d'amorces si vous pouvez m'expliquer pourquoi vous choisiriez l'une ou l'autresimplement ce serait super ! merci beaucoup

Sur le même thème :

Discussions similaires

  1. Question pratique
    Par yo47 dans le forum Chimie
    Réponses: 2
    Dernier message: 29/06/2011, 14h21
  2. [Biologie Moléculaire] question sur la QPCR
    Par marion49 dans le forum Biologie
    Réponses: 11
    Dernier message: 05/11/2010, 16h25
  3. réseaux de neurones : exemple pratique
    Par esauser dans le forum Mathématiques du supérieur
    Réponses: 1
    Dernier message: 16/01/2010, 19h19
  4. [probabilité] question à propos d´un exemple type
    Par Bartolomeo dans le forum Mathématiques du supérieur
    Réponses: 3
    Dernier message: 30/06/2009, 12h33
  5. Exemple type de question.
    Par guizmo_11 dans le forum TPE / TIPE et autres travaux
    Réponses: 1
    Dernier message: 14/03/2007, 14h45