Répondre à la discussion
Affichage des résultats 1 à 2 sur 2

comment choisir les AMORCES ?



  1. #1
    Bio-Mic20

    comment choisir les AMORCES ?


    ------

    Bonsoir
    je sais qu'il faut utiliser une amorce sens et une autre anti sens pour vérifier l'intégration chromosomique d'un gène : l’information que j'ai eu c'est que je dois dessiné un primer sur la fin de ce gène et un autre sur le début afin de confirmer l'intégration chromosomique du gène.
    SVP Comment choisir les amorces dans la séquence ? leur taille? et comment arriver a dessiner ces primer !!
    Merci

    -----

  2. #2
    -vipere-

    Re : comment choisir les AMORCES ?

    Bonsoir, si ça peut aider : http://forums.futura-sciences.com/bi...orces-pcr.html

    Dessiner ça aide bien

    Exemple :

    soit la séquence 5' AAGTGCTACTAACCAGTGGACTCTTAATAC TCTTTCATCATACTACT 3' à amplifier.

    amorce sens : AAGTGCTACTAACCA
    amorce anti-sens : AGTAGTATGAT...(complémentaire inversée)

    A partir de l'amorce sens va être synthétisée le brin sens (5' _ 3')
    A partir de l'autre, le brin anti-sens (3'_5')

    Cordialement

Discussions similaires

  1. Réponses: 0
    Dernier message: 05/12/2013, 20h49
  2. [Biologie Moléculaire] Comment design des amorces PCR..
    Par baylife dans le forum Biologie
    Réponses: 4
    Dernier message: 11/05/2013, 13h20
  3. Comment choisir son AOP?
    Par nivek69 dans le forum Électronique
    Réponses: 1
    Dernier message: 09/05/2008, 11h47
  4. Réponses: 2
    Dernier message: 02/05/2007, 19h46
  5. APN ... comment choisir ?
    Par freesbeep dans le forum Matériel - Hardware
    Réponses: 41
    Dernier message: 12/09/2005, 13h17
Découvrez nos comparatifs produits sur le sport et la santé.