Bonjour, cliquez-ici pour vous inscrire et participer au forum.
  • Login:



+ Répondre à la discussion
Affichage des résultats 1 à 10 sur 10

La transcription de l'ADN

  1. azerty58

    Date d'inscription
    octobre 2007
    Messages
    11

    La transcription de l'ADN

    Bonjour tout le monde,
    je voudrais savoir comment identifier le brin transcrit dans la séquence ADN suivante:
    ATGCTGACGATCGCTA
    TACGACTGCTAGCGAT
    merci de votre aide.


    De la discussion jaillit la lumière
     


    • Publicité



  2. jmbowie

    Date d'inscription
    avril 2006
    Âge
    31
    Messages
    997

    Re : La transcription de l'ADN

    Citation Envoyé par azerty58 Voir le message
    Bonjour tout le monde,
    je voudrais savoir comment identifier le brin transcrit dans la séquence ADN suivante:
    ATGCTGACGATCGCTA
    TACGACTGCTAGCGAT
    merci de votre aide.


    (Décidement).

    Le brin transcrit est celui qui contient l'information codante. Il faut regarder quel brin, dans au moins une des trois cadres de lectures possibles, contient à la fois un codon START (voir cours ou code génétique) mais pas de codon STOP (voir cours ou code génétique).
     

  3. Fpopino

    Date d'inscription
    octobre 2007
    Âge
    25
    Messages
    2

    Re : La transcription de l'ADN

    Tu peux pas identifier le brin transcrit comme sa a partir de rien surtout sur une sequence si petite. Si t'a l'Arn correspondant tu peux retrouver le brin transcrit qui est alors le brin complementaire de l'arn.
     

  4. Novocaine

    Date d'inscription
    août 2007
    Localisation
    Bordeaux
    Âge
    27
    Messages
    1 042

    Re : La transcription de l'ADN

    Salut, c'est pas plutôt le brin non transcrit qui est codant? Le brin transcrit va donner un ARNm à l'image du brin non transcrit. Le code(pour la séquence d'acides aminés) est donc porté par le brin non transcrit!

    Dans ce cas, Il faut regarder quel brin peut produire par complimentarité le codon start et le codon stop. Ici le brin transcrit et le 2eme car tu vois bien que lorsqu'il sera transcrit il produira un ARNm à l'image du 1er qui possède un codon start et un codon stop! (Sauf que T sera replacé par U).

    N°1 est codant, n°2 est transcrit.

    A+
     

  5. Novocaine

    Date d'inscription
    août 2007
    Localisation
    Bordeaux
    Âge
    27
    Messages
    1 042

    Re : La transcription de l'ADN

    Salut Fpopino,
    On peut car on voit qu'il y a un codon start(AUG). Il n'y a pas de codon stop par contre, c'est juste un petit fragment mais ça suffit pour l'exercice.
     


    • Publicité



  6. jmbowie

    Date d'inscription
    avril 2006
    Âge
    31
    Messages
    997

    Re : La transcription de l'ADN

    Citation Envoyé par Novocaine Voir le message
    Salut, c'est pas plutôt le brin non transcrit qui est codant? Le brin transcrit va donner un ARNm à l'image du brin non transcrit. Le code(pour la séquence d'acides aminés) est donc porté par le brin non transcrit!

    Dans ce cas, Il faut regarder quel brin peut produire par complimentarité le codon start et le codon stop. Ici le brin transcrit et le 2eme car tu vois bien que lorsqu'il sera transcrit il produira un ARNm à l'image du 1er qui possède un codon start et un codon stop! (Sauf que T sera replacé par U).

    N°1 est codant, n°2 est transcrit.

    A+
    Non non, le brin transcrit= le brin codant = celui portant l'information. Mais le brin transcrit n'est pas celui qu'utilise l'ARN polymérase, de là vient la confusion!
    Le brin qui porte l'information (que je nomme brin transcrit) n'est pas celui utilisé comme matrice (que j'appelle brin matrice et que tu nommes "transcrit").
    Codant = "transcrit", dans le sens de "relai d'information" et non de "l'enzyme utilise pour faire un complémentaire ARN"
     

  7. orthank

    Date d'inscription
    janvier 2004
    Âge
    28
    Messages
    92

    Re : La transcription de l'ADN

    Citation Envoyé par jmbowie Voir le message
    Non non, le brin transcrit= le brin codant = celui portant l'information. Mais le brin transcrit n'est pas celui qu'utilise l'ARN polymérase, de là vient la confusion!
    Le brin qui porte l'information (que je nomme brin transcrit) n'est pas celui utilisé comme matrice (que j'appelle brin matrice et que tu nommes "transcrit").
    Codant = "transcrit", dans le sens de "relai d'information" et non de "l'enzyme utilise pour faire un complémentaire ARN"
    Je crois qu'il doit y avoir une confusion.
    Pour résumer le tout, voici un exemple de séquence d'ADN double brin:
    BRIN 1: 5' AGGGGCCCGGATCGGTTATGTGCG 3'
    BRIN 2: 3' TCCCCGGGCCTAGCCAATACACGC 5'

    Après passage de l'ARN polymérase on obtient ceci:
    TRANSCRIT ARN: 5' AGGGGCCCGGAUCGGUUAUGUGCG 3'

    Le BRIN 1 peut être appelé le brin non transcrit ou le brin codant.
    Le BRIN 2 peut être appelé le brin transcrit, le brin matrice ou le brin non codant.
    Le TRANSCRIT ARN est complémentaire au BRIN 2.
     

  8. Novocaine

    Date d'inscription
    août 2007
    Localisation
    Bordeaux
    Âge
    27
    Messages
    1 042

    Re : La transcription de l'ADN

    Oui, je suis d'accord avec orthank. Entre nous jmbowie, je confonds tout le temps donc bon
     

  9. azerty58

    Date d'inscription
    octobre 2007
    Messages
    11

    Re : La transcription de l'ADN

    Je voudrais justement savoir lequel des deux brins 1 ou 2 sera transcrits ?
    Dernière modification par azerty58 ; 22/10/2007 à 21h00.
    De la discussion jaillit la lumière
     

  10. Novocaine

    Date d'inscription
    août 2007
    Localisation
    Bordeaux
    Âge
    27
    Messages
    1 042

    Re : La transcription de l'ADN

    Je te l'ai dit! le numéro 2 !Ah, si tu ne lis pas les réponses aussi..
    Et il faut surtout retenir les explications pour pouvoir le trouver tout seul...
    A moins que tu n'aies toujours pas compris? (n'hésites pas à le dire dans ce cas)
     


    • Publicité




Poursuivez votre recherche :




Sur le même thème :




 

Discussions similaires

  1. [Biologie Moléculaire] transcription
    Par RACHIDA dans le forum Biologie
    Réponses: 7
    Dernier message: 07/02/2008, 17h31
  2. transcription
    Par biscotte91 dans le forum Biologie
    Réponses: 11
    Dernier message: 19/04/2007, 21h28
  3. Transcription
    Par RACHIDA dans le forum Biologie
    Réponses: 1
    Dernier message: 21/03/2007, 12h38
  4. transcription
    Par tnani dans le forum Biologie
    Réponses: 8
    Dernier message: 15/03/2007, 15h23
  5. Transcription or not transcription
    Par Meningo dans le forum Biologie
    Réponses: 22
    Dernier message: 18/04/2005, 12h02

Les tags pour cette discussion