Répondre à la discussion
Affichage des résultats 1 à 14 sur 14

Une technique de séquençage simple



  1. #1
    Bruno

    Une technique de séquençage simple


    ------

    Bonjour (ou plutot bonsoir),

    Dans le cadre d'un travail de bio, j'essaye de trouver une technique de séquençage de génome la plus simple possible, de façon à expliquer ça le plus clairement possible. Malheureusement, mes recherches m'ont mené, pour l'instant en tout cas, qu'à des tecniques où je décroche dès la troisième ligne...

    Si vous aviez ne fus-ce qu'un nom à balancer (ne m'expliquez surtout pas, de 1 ce serait déplacé de ma part de vous laisser faire ça, et de 2 je préfère chercher) j'essaierai d'orienter mes recherches là-dessus.

    Je vais continuer à fouiner sur le net, dans la biblio puante et poussiéreuse de ma commune, dans celle un peu moins désagréable de mon école, et si entre temps quelq'un poste qqch ici, je lui dit d'ores et déjà un grand MERCI !!!

    Bon allez je retourne à mes recherches, j'ai la nuit devant moi (youpiiiee......) !

    Cordialement,

    -----
    « Il faut dire la vérité, mais on peut l'arranger. » -- Emily Dickinson

  2. Publicité
  3. #2
    Douviss

    Re : Une technique de séquençage simple

    La méthode utilisée aujourd’hui, proposée par F. Sanger

  4. #3
    Etoile

    Re : Une technique de séquençage simple

    Bonjour,

    J'aurai aussi proposé la méthode de Sanger , ou celle de séquençage automatique, basée sur le même principe mais qui utilise des marqueurs fluorescents au lieu des marqueurs radioactifs.

    Bonnes recherches !

    *
    *Etoile*

  5. #4
    orthank

    Re : Une technique de séquençage simple

    Pour des informations sur le séquençage des génomes (méthode automatique), je te conseille la FAQ du Genoscope.
    Fais les recherches de ton côté et si tu as des questions n'hésites surtout pas!

  6. #5
    Bruno

    Re : Une technique de séquençage simple

    Bonjour et merci pour vos réponses.

    Concernant la méthode de Sanger, il est question d'une amorce. Est-ce que cette amorce se rétrécit au cours du temps, à force de répliquer l'ADN ? Si oui, alors s'agit-il de ces extrémités d'ADN qui sont de plus en plus raccourcies au fil du temps, et qui expliquent donc le vieillissement ?

    Merci.
    « Il faut dire la vérité, mais on peut l'arranger. » -- Emily Dickinson

  7. A voir en vidéo sur Futura
  8. #6
    oui_oui

    Re : Une technique de séquençage simple

    Salut,
    comme ce qui a été dit plus haut, le séquençage des génomes se fait grâce à la méthode de Sanger.

    Les amorce que l'on ajoute au début ne sont la que pour faire démarrer l'ADN polymérase.
    En effet l'ADN polymérase ne peut faire sont travail (créer le brin complémentaire) que si le début est déjà commencé...

    (sur cette image, le brin d'ADN à séquencer est en gris et l'amorce est en rouge)


    Cette technique est totalement artificielle, elle ne sert qu'au séquençage des génomes. Toutes ces réaction se font dans des appareils (séquenceur automatique) et ne sont absolument pas lié au vieillissement cellulaire.
    (Ce à quoi tu fais allusion c'est le raccourcissement des chromosomes au fur et a mesure des division cellulaire).

    En esperant t'avoir un peu eclairci les idées...
    Bon courage
    Oui_oui

  9. Publicité
  10. #7
    Bruno

    Re : Une technique de séquençage simple

    Salut,

    Ok, donc l'amorce n'est qu'un artifice, rien à voir avec le vieillissement.

    Une autre question: au début du séquençage, lors de la préparation du milieu, on ajoute de l'ADN polymérase, le brin à séquencer (+ les ddNTP et dNTP ça j'ai compris). Mais est-ce qu'on ne procède pas d'abord une une réplication massive du brin à séquencer avant de commencer le-dit séquençage ?


    Merci.
    « Il faut dire la vérité, mais on peut l'arranger. » -- Emily Dickinson

  11. #8
    piwi

    Re : Une technique de séquençage simple

    Non ca n'est pas la peine. Il est certain qu'il faut une certaine quantité du brin à séquencer mais ceci est deja contenu dans la banque de fragments du génome de l'organisme que tu veux étudier.

    Je suppose que tu as deja vu ce lien: http://www.snv.jussieu.fr/vie/dossie...e/sequence.htm

    Cordialement,
    piwi

  12. #9
    Bruno

    Re : Une technique de séquençage simple

    Donc on fait tout le séquençage à partir d'un seul brin d'ADN ?
    « Il faut dire la vérité, mais on peut l'arranger. » -- Emily Dickinson

  13. #10
    oui_oui

    Re : Une technique de séquençage simple

    Non tu n'en n'as pas qu'un seul.
    On en dessine qu'un sur les schémas mais tu en a beaucoup.
    Avant le sequençage on possede une banque (c'est a dire une "bibliothèque") dans laquelle il y a nos fragments a sequencer. Il suffit de les faire se mutliplier et on en obtient un grand nombre.

  14. #11
    Bruno

    Re : Une technique de séquençage simple

    Ok merci beaucoup.

    Je viens de faire quelques schémas afin de rendre tout cela plus clair.



    En particulier, j'ai schématisé le résultat d'un séquençage :



    J'en déduis donc : AGCCGAGCTAGCTGGTAATGTCCT

    Et par complémentarité des base, le brin à séquencer contenait : TCGGCTCGATCGACCAATTCAGGA .

    Si quelqu'un pouvait vérifier la bonne transposition, il y a peut être une faute de frappe que je ne vois pas. Merci
    « Il faut dire la vérité, mais on peut l'arranger. » -- Emily Dickinson

  15. #12
    orthank

    Re : Une technique de séquençage simple

    En fait la séquence que tu lis du bas vers le haut sur ton gel correspond à la séquence qui a été synthétisé lors du séquençage par la polymérase.
    Ce qui correspond à: 5' TCCTGTAATGGTCGATCGAGCCGA 3'
    Tu retrouves donc la séquence d'ADN matrice par complémentarité:
    3' AGGACATTACCAGCTAGCTCGGCT 5'

  16. Publicité
  17. #13
    Bruno

    Re : Une technique de séquençage simple

    Citation Envoyé par orthank Voir le message
    En fait la séquence que tu lis du bas vers le haut sur ton gel correspond à la séquence qui a été synthétisé lors du séquençage par la polymérase.
    Ce qui correspond à: 5' TCCTGTAATGGTCGATCGAGCCGA 3'
    Tu retrouves donc la séquence d'ADN matrice par complémentarité:
    3' AGGACATTACCAGCTAGCTCGGCT 5'
    Ok, il suffit donc d'inverser l'ordre pour ce que j'ai obtenu.

    Par contre je ne comprend pas ce que signifient le "3'" et 5' qui encerclent mon bout de code ?
    « Il faut dire la vérité, mais on peut l'arranger. » -- Emily Dickinson

  18. #14
    orthank

    Re : Une technique de séquençage simple

    La notation 5' - 3' correspond à la polarité d'une séquence d'ADN (ou d'ARN). Ces chiffres proviennent de la nomenclature des carbones du ribose (image). On parle dans le cas du ribose de carbone 3' et non de carbone 3, celui-ci étant utilisé dans la nomenclature des bases azotées (A,T,C,G,U).
    Ainsi la liaison qui s'établit entre deux nucléotides (appellée liaison 5'-3' phosphodiester) est réalisée entre le carbone 5' du premier nucléotide et le carbone 3' du second nucléotide.
    Dans le cas de l'ADN, des brins étant appariés de manière complémentaire et anti-parallèle ont une polarité inversée (image).
    Exemple de deux brins d'ADN appariés, complémentaires et anti-parallèles :
    5' ACGGCTGATCGCTAGT 3'
    3' TGCCGACTAGCGATCA 5'

Sur le même thème :

Discussions similaires

  1. [Biologie Cellulaire] technique du simple hybride
    Par dieu_x dans le forum Biologie
    Réponses: 0
    Dernier message: 09/12/2007, 17h08
  2. [Biologie Moléculaire] le séquençage??? une petite question
    Par gilbert2002 dans le forum Biologie
    Réponses: 4
    Dernier message: 21/11/2007, 14h08
  3. Une technique laser permettant une microproduction 3D haute résolution
    Par RSSBot dans le forum Commentez les actus, dossiers et définitions
    Réponses: 0
    Dernier message: 13/12/2006, 13h49
  4. Le temps a t il une origine ou est il une simple invention
    Par maxou dans le forum [ARCHIVE] Philosophie
    Réponses: 25
    Dernier message: 22/10/2004, 00h33