Répondre à la discussion
Page 1 sur 2 1 DernièreDernière
Affichage des résultats 1 à 30 sur 38

ADN traduit



  1. #1
    Solène

    Red face ADN traduit


    ------

    Bonjours à tous

    Voila je viens d'avoir un controle et il y a un truc qui me turlupine...
    On avait un ADN double brin synthétisé à partir d'un ARNm et le brin traduit de cet ADN était séquencé donc on devait retrouver la séquence de bases et et la séquence d'acides aminés correspondante.
    Ma question est donc : à quel brin d'ADN correspond le brin traduit parceque pour moi c'est l'ARNm qui est traduit pas l'ADN... on m'aurais mis le brin transcrit ça aurais été mais là...

    Merci

    PS : Pour info j'ai donc mis que c'était le brin non transcrit mais du cou la séquence polypeptidique de mon gène ne commençait pas par une methionine...

    -----

  2. Publicité
  3. #2
    ggpessoa

    Re : ADN traduit

    le brin traduit de cet ADN
    Je suis désolé tes profs ne parlent pas français !! On dit cette proteine traduite de cet ARNm et pas autre chose ! La traduction est la synthèse d'une protéine à partir d'un transcrit et on aboutit donc à une protéine et non à un brin !

    A partir de là l'exercice n'est pas faisable ou bien c'est toi qui a mal lu l'énnoncé.

  4. #3
    mytikjuve

    Re : ADN traduit

    La notion de brin traduit existe bien desolé, mais elle est due a une mauvaise traduction de l'anglais, ce qui crée un ambiguité.
    Il me semble, que le brin traduit est le brin non transcrit, mais cela est a vérifier. Ce brin si je ne me trompe pas est utilisé car il permet de trouver l'ARNm en remplacant les T par des U. Ceci est encore a verifier car je ne me rappelle plus très bien.
    A moin que je ne confonde avec codant non codant. Finalement si quelqu'un pouvait repondre a ce probleme cela m'arrangerait beaucoup. merci
    Dernière modification par mytikjuve ; 14/12/2004 à 22h54.
    "Et si on etait tous là pour s'améliorer, on tuerait l'ignorance pour cesser de s'ignorer" Trijas

  5. #4
    Vinc

    Re : ADN traduit

    Salut!
    Jusqu'à preuve du contraire, la traduction est le passage d'ARNm en protéine et c'est la transcription qui donne de l'ARNm à partir d'ADN. Donc si tu parles de "brin traduit", c'est un brin d'ARNm qui est traduit en protéine, comme l'a signalé ggpessoa....
    Vinc
    Primum non nocere.

  6. #5
    ggpessoa

    Re : ADN traduit

    C'est simple il y a un brin qui est utilisé pour la transcription, c'est le brin transcrit ou brin matrice. Le deuxième brin n'est pas transcrit, il est complémentaire cependant du brin matrice et possède donc la même séquence (sauf T au lieu de U) que l'ARNm. C'est le brin dit 'codant'.

    Parler de brin d'ADN traduit est une abérration énorme !

  7. A voir en vidéo sur Futura
  8. #6
    Yoyo

    Re : ADN traduit

    Bonsoir,

    En effet parler de brin d'ADN traduit est étrange et ne correspond a rien biologiquement. Meme si on comprends le "raccoui" qui pourrait etre fait.
    brin traduit=brin d'ADN identique a l'ARNm=brin non transcript.

    mais ce racourcit est dangereux car il porte a confusion.

    yoyo

  9. Publicité
  10. #7
    LaBoOm

    Re : ADN traduit

    tu dois prendre le brin de gauche ...et après le transformer en arn messager en changeant les bases t par u et les 2 autres dont je ne me souviens plus très bien dsl

  11. #8
    Solène

    Re : ADN traduit

    Merci de vos réponses

    Je suis absolument certaine d'avoir bien lu mon énoncé j'ai complètement bugger dessus quand j'ai vu cette notion de brin d'ADN traduit !!!
    J'ai également reconstitué la séquence polypeptidique à partir du brin transcrit et cette fois-ci ma séquence commençait bien par une met.
    Je crois que je vais carrément écrire à mon prof et lui demander parcque c'était vraiment viscieux comme sujet...

  12. #9
    ggpessoa

    Re : ADN traduit

    Demande lui surtout de se remettre en question !! Je trouve ça assez scandaleux et anti-pédagogique comme démarche. Mais ce n'est que mon avis.

  13. #10
    Solène

    Re : ADN traduit

    Voici l'explication de ma prof :

    J'ai le texte du problème sous les yeux. Il est écrit : "La partie encadrée en pointillée correspond à la séquence de la totalité de la partie traduite de l'ADNc".
    Le cDNA a été synthétisé à partir d'un mRNA. Il est clair que c'est le mRNA qui est traduit et qu'il s'agit ici de la séquence traduite du mRNA (simple brin) que l'on retrouve dans la séquence du cDNA (double brin). Comme les 2 brins sont complémentaires, il suffit de séquencer l'un des deux brins et d'analyser correctement les résultats pour répondre à la 2ème question.
    Donc c'était le brin transcrit ! Pas si clair que ça...

  14. #11
    Yoyo

    Re : ADN traduit

    Bonsoir

    "la partie traduite de l'ADNc" indique simplement que la région encadrée ne contient pas les séquences non traduites sur l'ARNm, mais simplement la phase codante.

    Ce n'est pas une facon tres pédagogique de dire les choses la facon correcte aurait ete:
    La partie encadrée en pointillée correspond à la séquence de la totalité de la région traduite de l'ARNm reverse transcrite en ADNc.

    yoyo

  15. #12
    ggpessoa

    Re : ADN traduit

    Non c'est bien toi qui a mal lu l'énnoncé. L'énnoncé est plutôt clair. Il faut faire attention lorsqu'on site un prof ou un énnoncé à ne pas 'déformer' ses propos.

    Mais en effet comme dit Yoyo ce n'est pas très pédagogique.
    Dernière modification par ggpessoa ; 15/12/2004 à 17h39.

  16. Publicité
  17. #13
    Solène

    Re : ADN traduit

    Ah mais oui tout à fait...
    Il ne me reste plus qu'à me donner des claques j'aurais pas du relire ma copie j'aurais laissé mon raisonnement premier qui était le bon !!!!!
    C'est navrant

  18. #14
    oceane86p

    Re : ADN traduit

    j'ai une kestion ke je n'arrive pas a repondre :

    "ecrire la portion d'ADN codant la synthése de la chaine polypeptidique : UGG-AGA-GCG-UGC-UUC-UAC-ACU-CCU-AAG-ACU"

    aidez moi svp

    Tout d'abord un minimum de politesse n'est jamais superflu, surtout quand on cherche de l'aide. Ensuite merci d'ecrire correctement, le SMS n'est pas toléré ici. Enfin tu pourrais crée une discusion pour ta question, mais on n'est pas la pour te faire l'exo a ta place. Yoyo
    Dernière modification par Yoyo ; 11/12/2005 à 17h19.

  19. #15
    guy52

    Re : ADN traduit

    Bonjour

    Oceane86P est-ce bien l'intitulé exact de la question?

  20. #16
    oceane86p

    Re : ADN traduit

    Oui. c'est exatemet la question. je les faits mais je suis pas certaine.
    il fau remplacer les lettres pour que ca deviene une chaine d'ADN?

  21. #17
    doublej

    Re : ADN traduit

    Salut,

    La séquence qui est donnée est celle d l'ARN messager ( on la reconnait à la présence d'uracile U)
    Pour obtenir la séquence d'ADN codant pour la synthèse de la protéine il faut ecrire la séquence complémentaire de la séquence donnée.
    ATTENTION: lorsque on a une Adénine ( A ) sur l'ARN la base complémentaire est une Thymine ( T ) sur l'ADN et pas une Uracile ( U ).

    J'espère que tu as compris sinon je préciserai.

  22. #18
    oceane86p

    Re : ADN traduit

    je te remercie beaucoup.

  23. Publicité
  24. #19
    spallanzani1

    Re : ADN traduit

    Citation Envoyé par Yoyo
    Bonsoir,

    En effet parler de brin d'ADN traduit est étrange et ne correspond a rien biologiquement. Meme si on comprends le "raccoui" qui pourrait etre fait.
    brin traduit=brin d'ADN identique a l'ARNm=brin non transcript.

    mais ce racourcit est dangereux car il porte a confusion.

    yoyo
    bonsoir yoyo
    je vous contacte car je vois que vous avez l'air de maitriser la genetique ce qui n'est pas mon cas!
    En effet j'ai un problème je n'arrive pas à distinnguer le brin matrice du brin codant quand on est en presence d'une molecule double brin d'ADN.
    voici la sequence correspondant au fragment d'ADN double brin:
    5'-TGATAGCTATGTGACTCCTCTAACATGGTG TAA-3'(1)
    3'-ACTATCGATACACTGAGGAGATTGTACCAC ATT-5'(2)
    Alors ma question est la suivante: on sait qu'apres la transcription, on va obtenir un ARNm qui va être traduit en proteines... Comment donc savoir le brin codant à partir de la molecule double brin sachant que sur la première molecule(1), on a deux ATG et sur le second(2) un seul?
    je vous prie de merepondre... Et merci d'avance

  25. #20
    Yoyo

    Re : ADN traduit

    Bonjour

    pour identifier le brin interessant faut determiner le quel a la capacité de coder une protéine.
    pour le brin 1.
    '-TGATAGCTATGTGACTCCTCTAACATGGTG TAA-3'
    Il y a un codon stop (TGA) juste apres le premier ATG, il ne peut donc y avoir aucune protéine de synthetisée. Pour le deuxieme on on retrouve un codon stop (TAA) 1 codon apres l'ATG donc la aussi aucune protéine de synthetisée.

    Pour le brin 2.
    3'-ACTATCGATACACTGAGGAGATTGTACCAC ATT-5'
    comme la traduction se fait toujours de 5'->3' il est plus pratique de l'ecrire dans l'autre sens.

    5'TTACACCATGTTAGAGGAGTCACATAGCTATCA3'

    encore une fois j'ai mis en gras le seul codon ATG present.
    or a partir de ce codon la on obtient la protéine suivante : MLEESHSY
    Il est donc probable que dans cet expl precis ce soit lui le brin codant, mais il nous manque une partie de la sequence pour connaitre la sequence complete de la protéine.


    YOyo
    Dernière modification par Yoyo ; 14/04/2006 à 09h44.

  26. #21
    spallanzani1

    Re : ADN traduit

    Citation Envoyé par Yoyo
    Bonjour

    pour identifier le brin interessant faut determiner le quel a la capacité de coder une protéine.
    pour le brin 1.
    '-TGATAGCTATGTGACTCCTCTAACATGGTG TAA-3'
    Il y a un codon stop (TGA) juste apres le premier ATG, il ne peut donc y avoir aucune protéine de synthetisée. Pour le deuxieme on on retrouve un codon stop (TAA) 1 codon apres l'ATG donc la aussi aucune protéine de synthetisée.

    Pour le brin 2.
    3'-ACTATCGATACACTGAGGAGATTGTACCAC ATT-5'
    comme la traduction se fait toujours de 5'->3' il est plus pratique de l'ecrire dans l'autre sens.

    5'TTACACCATGTTAGAGGAGTCACATAGCTATCA3'

    encore une fois j'ai mis en gras le seul codon ATG present.
    or a partir de ce codon la on obtient la protéine suivante : MLEESHSY
    Il est donc probable que dans cet expl precis ce soit lui le brin codant, mais il nous manque une partie de la sequence pour connaitre la sequence complete de la protéine.


    YOyo
    RE bonjour,
    je suis d'accord avec vous sur la façon de proceder pour determiner le brin codan. JE pense que ceci est vrai dans le cas où on serait en presence d'un organisme eucaryote(premier AUG vu, premier AUG pris par la polymerase..."initiation de la transcription ches les euracyotes).
    Neamoins concernant le brin(1)
    -TGATAGCTATGTGACTCCTCTAACATGGTG TAA-3', le deuxieme ATG peut aussi initier la traduction si on considère que l'organisme considéré est procaryote !!!Donc je ne vois pas pourquoi on s'interesserait plus tôt au premier ATG qu'au second! Dans ce cas on aurait une proteine, plutôt un tripeptide de formé(quoi que un tripeptide est aussi une proteine):MVY

  27. #22
    Vinc

    Re : ADN traduit

    Salut!
    Citation Envoyé par spallanzani1
    Neamoins concernant le brin(1)
    -TGATAGCTATGTGACTCCTCTAACATGGTG TAA-3', le deuxieme ATG peut aussi initier la traduction si on considère que l'organisme considéré est procaryote !!!Donc je ne vois pas pourquoi on s'interesserait plus tôt au premier ATG qu'au second! Dans ce cas on aurait une proteine, plutôt un tripeptide de formé(quoi que un tripeptide est aussi une proteine):MVY
    Non, car comme l'a bien signalé Yoyo, juste derrière le deuxième ATG, tu as également un codon STOP TAA... Donc dans cet exemple sur le brin(1), les 2 ATG ne donneront pas de protéines car ils sont suivis tous les 2 d'un STOP qui arrête la synthèse!

    A+
    Vinc
    Primum non nocere.

  28. #23
    hexapat

    Re : ADN traduit

    Pardon mais aussi, un tri peptide n'est pas une prtéine !!

  29. #24
    hexapat

    Re : ADN traduit

    C'est un protide voilà tout !

  30. Publicité
  31. #25
    Yoyo

    Re : ADN traduit

    De toute facon il n'est meme pas question de tripeptide, a la rigueur de di-peptide...

    Ces tout petits peptides existent et sont codés majoritairement par ce que l'on appel des uORFs qui se trouvent en général dans les régions 5' UTR des ORFS.

    YOyo

  32. #26
    spallanzani1

    Re : ADN traduit

    autant pour moi!!! En tout cas je vous remercie de m'avoir eclairé sur ce sujet! En fait je confondais peptide(<=20acides aminés) à une petite proteine(ayant une succession d'acides amines compris entre 20 et 100aa) donc vous comprenez bien mon tracas!!!
    fo que je revois mes cours de biochimie de 1è annee

  33. #27
    spallanzani1

    Re : ADN traduit

    bonjour à tous;
    j'ai une question qui me tracasse:
    j'ai deux molecules simple brin d'ADN
    5'TTACGATATGGGAATCGTACGCAATCGA TTAGAGGTAGTC-'
    5'TTACGATATGGGAATCGTACGCAATTGA TTAGAGGTAGTC-'
    comment fait on pour trouver les sequences d'ARN et d'acides aminés qui resultent de la transcription/traduction de ces deux sequences?

    Moi j'ai procédé de cette façon je ne sais pas si c'est la meilleure:
    -j'ai fait la transcription des deux molécules d'ADN ce qui m'a donné les deux ARN suivant:
    *pour le brin superieur:
    5'GACUACCUCUAAUCGAUUGCGUACGAUU CCCAUAUCGUAA
    *pour le brin inferieur je trouve:
    5'GACUACCUCUAAUCAAUUGCGUACGAUU CCCAUAUCGUAA

    Et pour trouver la sequence en Acides aminé je pars de la molécule d'ARNm(5'-3') et je cherche le premier AUG
    pour le premier brin :
    pas de AUG present donc pas d'acide aminé!!! c bizarre
    pour le second brin:
    c la même chose.
    JE trouve cependant que ya quelque chose qui cloche: pour chercher la sequence en acides aminés, on part de la molécule d'ADN ou d'ARN?
    merci pour votre réponse

  34. #28
    Yoyo

    Re : ADN traduit

    regarde de plus pret tes sequences! en plus ta question est strictement identique a la precedente, donc si tu as compris nos reponses tu ne devrais avoir aucune difficulté pour répondre a cette question.

    POur cette question:
    JE trouve cependant que ya quelque chose qui cloche: pour chercher la sequence en acides aminés, on part de la molécule d'ADN ou d'ARN?
    CA n'a aucune importance a partir du moment ou tu prends le bon brin d'ADN. La seule diffférence entre ADN et ARN etant les U remplacés par des T... donc sur le papier ca ne change rien. Biensur dans la cellule seuls les ARN sont traduits.

    YOyo

  35. #29
    spallanzani1

    Re : ADN traduit

    ma première question consernait uniquement le brin codant!
    cependant dans le cas present je n'ai que deux molecules simple brin d'ADN et non une molécule double brin

  36. #30
    synchrotron

    Re : ADN traduit

    C'est un peu faux je trouve de dire "le brin codant", étant donné que le brin d'ADN qui est transcrit est la séquence complémentaire de celle qui sera traduite une fois sous forme d'ARN. C'est déjà plus exact de parler de brin sens ou anti-sens je trouve. A ce moment là, si on te demande de transcrire les 2 brins que tu nous a montré, ce sont des brins d'ADN anti-sens puisque ce sont des brins matrices. En revanche, un brin codant est sens et n'est pas transcrit. Peut-être ça a déjà été dit dans ce post mais j'ai pas regardé plus haut, désolé .

    Pour ta question, les 2 séquences doivent être les brins sens, c'est à dire même séquence que l'ARN, ce sont donc des brins codants. C'est leur brin complémentaire qu'il faut transcrire, donc pour transcrire, tu reprends les séquences données et tu ne fais que changer les T par U. De cette façon, tu as bien des ATG!

    A+.
    les hommes veulent tout connaitre de l'univers,les XTsiens se contentent de l'observer

Sur le même thème :

Page 1 sur 2 1 DernièreDernière

Discussions similaires

  1. [Biologie Moléculaire] l'hybridation ADN/ADN "les différent méthodes???"
    Par Hamza2lh dans le forum Biologie
    Réponses: 3
    Dernier message: 07/11/2007, 10h18
  2. 'The Road to Reality' de R. Penrose enfin traduit
    Par Fishbedfan dans le forum Lectures scientifiques
    Réponses: 3
    Dernier message: 14/08/2007, 21h58
  3. Réponses: 6
    Dernier message: 09/12/2006, 09h47
  4. Adn
    Par lagwagon dans le forum Biologie
    Réponses: 4
    Dernier message: 02/11/2005, 17h34
  5. ADN nu
    Par mag dans le forum Biologie
    Réponses: 0
    Dernier message: 19/04/2005, 17h35