Répondre à la discussion
Affichage des résultats 1 à 23 sur 23

svt: brin transcrit



  1. #1
    poopo

    Smile svt: brin transcrit

    Bonjour,

    voila j'ai un exo rapide a faire mais je voudrais savoir si c'est juste en plus c'est pour demain

    une sequence du brin non transcrit de cette allele est reproduite en partie ci dessous

    ATGGTGCATCTGACTCCTGAG

    voila ce que j'ai fait

    ARNm= AUG GUG CAU CUG ACU CCU GAG
    Méthionine Valine Histidine Leucine Thréonine Proline Glutamate

    J'ai espacer pour que vous compreniez plus merci d'avence

    salutation

    -----


  2. Publicité
  3. #2
    gorben

    Re : svt

    Salut,

    c'est juste !

    Question subsidiaire : ca aurait donne quoi si ca avait ete la sequence du brin codant?

    A+

  4. #3
    bra cqa

    Re : svt

    salut,c just pour te confirm que votre reponse est juste.............

  5. #4
    Keitaro44

    Re : svt

    Citation Envoyé par gorben Voir le message
    Question subsidiaire : ca aurait donne quoi si ca avait ete la sequence du brin codant?
    Attention avec cette appellation. Mon prof de bio mol nous a dit que le brin codant pouvait désigner, selon les biologistes, le brin transcrit ou non transcrit (ça dépend du point de vue qu'on a sur le mot "codant").

  6. #5
    gorben

    Re : svt

    Ben tu devrais redemander des explications a ton prof, parce que codant pour moi veut bien dire codant. Le fonctionnement de l'ARN pol est clair, je vois pas bien comment un brin codant pourrait etre transcrit et/ou non transcrit.
    J'ai beau chercher, meme les trucs bizarres mais non dsl je vois pas...


    A+

  7. A voir en vidéo sur Futura
  8. #6
    Effie

    Re : svt

    Le brin codant est le brin non transcrit! Personnellement je trouve plus "biologique" d'utiliser le terme de transcrit ou non (qui parle d'une réalité sur le fait qu"il sert ou non de matrice pour la transcription par l'ARN polymérase), que d'utiliser codant ou non (terme qui s'intéresse à la ressemblance entre un brin d'ADN, le non transcrit, et l'ARN messager).

  9. Publicité
  10. #7
    poopo

    Smile Re : svt

    salut desoler de pas vous avori repondu j'etais malade snif
    sinon j'ai une autre question mais je n'est pas compris : trouver un critere de classement des differenet allele

    allele 1: ATGGTGCACCTGACTCCTGAG

    allele2:ATGGTGCATCTGACTCCTGAG

    allele 3 : ATGGTGCACCTGACACCTGAG

    allele 4: ATGGTGCACCTGACTCCTGTG

    allele 5 : ATGGTGCACCTGACTCCTAAG

    allele6 : ATGGTGCACCTAACTCCTGAG

    (se sont des sequence des brins trnascrit ces allele) merci d'avance

  11. #8
    poopo

    Re : svt

    si vous plait aidez moii

  12. #9
    chimio-TermS

    Re : svt

    Et c'est quoi la question?

  13. #10
    poopo

    Re : svt

    trouver un critere de classement des differenet allele

    c'est celle la la question

  14. #11
    chimio-TermS

    Re : svt

    comment ça trouver un critère de classement?
    ça je n'ai pas compris!

  15. #12
    poopo

    Re : svt

    c'est pas grave mais esque je peut te demander une chose par msn car je n'arrive pas a poster l'image ? Si sa te derange pas merci d'avance

  16. Publicité
  17. #13
    chimio-TermS

    Re : svt

    Je viens de t'envoyer un MP.

  18. #14
    IngDr

    Re : svt

    Edit : voyant le harcellement dont tu as fait preuve, sur les autres topic, je retire mes conseils.
    Je te dirai juste que ton 2eme exo n'est pas différent du 1er.

    Et pour finir va voir ici : http://forums.futura-sciences.com/bi...-exercice.html

    Bon courage
    Dernière modification par IngDr ; 25/10/2008 à 22h52.

  19. #15
    poopo

    Re : svt

    alors pour les alleles 1 2 3 6 et ont les meme acide aminé alors que les allele 4 et 5 leur derniere acide aminé sont different mais aprés je n'y arrive pas

  20. #16
    Zellus

    Re : svt

    Salut,

    T'as pas plus d'infos ? Je dirais qu'on peut les classer par type de mutation peut-être ...
    Citation Envoyé par poopo
    se sont des sequence des brins trnascrit ces allele
    Ce sont vraiment les séquences transcrites ou les séquences codantes (non transcrites) ?

  21. #17
    poopo

    Re : svt

    salut ce sont des sequence non transcrit et je remarquer que pour les alleles 1 2 3 6 le code et redondant et pour les alleles le code est non amibgu

  22. #18
    Zellus

    Re : svt

    Oui, mutations silencieuses pour les allèles 1, 2, 3 et 6, mutations faux-sens pour les allèles 4 et 5. Mais ça suffit comme classement ?

  23. Publicité
  24. #19
    poopo

    Re : svt

    j'ai pas du tout compris zellus mutation faux sens mutation ...

  25. #20
    Zellus

    Re : svt

    Hé bien, si on prend ton allèle 1 comme référence, on passe de cet allèle 1 à l'allèle 2, 3 ou 6 par une simple mutation silencieuse, c'est à dire qu'on obtient au final le même acide aminé. Par contre pour passer de l'allèle 1 à l'allèle 4 ou 5, il y a une mutation faux-sens (un acide aminé est changé en un autre acide aminé et là ça peut être plus grave !).

  26. #21
    poopo

    Re : svt

    a oki mais alors comment on peut trouver les critere de classement des alleles

  27. #22
    poopo

    Re : svt

    si vous plait zellus

  28. #23
    Zellus

    Re : svt

    Oui je suis là ^^.
    Je ne vois pas vraiment d'autres possibilités que classer ces allèles en fonction du type de mutation (silencieuse/faux-sens). Tu prends l'allèle 1 comme référence et tu as deux groupes de mutants (allèles 2, 3 et 6 d'un côté et allèles 4 et 5 de l'autre).
    Sinon tu peux les classer en fonction de la séquence protéique qu'il vont donner. Et là tu aurais 3 groupes : les allèles 1, 2, 3 et 6 vont donner une séquence, l'allèle 4 va donner une autre séquence, et l'allèle 5 va en donner une troisième.
    Mais tu n'as pas un énoncé plus complet que celui-là ? Parce que franchement je le trouve assez nul cet exo. Tu as quel niveau d'études ?

Sur le même thème :

Discussions similaires

  1. [Biologie Moléculaire] brin sens / brin antisens
    Par mimismall dans le forum Biologie
    Réponses: 17
    Dernier message: 13/01/2013, 19h31
  2. [Biologie Moléculaire] Brin transcrit => Séquence de protéine
    Par Monstiney dans le forum Biologie
    Réponses: 1
    Dernier message: 22/10/2008, 18h48
  3. [Génétique] Brin transcrit
    Par amandinedu13 dans le forum Biologie
    Réponses: 5
    Dernier message: 20/10/2007, 20h11
  4. Brin non-transcrit
    Par Annyah dans le forum Biologie
    Réponses: 1
    Dernier message: 08/02/2007, 16h38
  5. repérer le brin transcrit
    Par snyfir dans le forum Biologie
    Réponses: 13
    Dernier message: 07/11/2005, 21h35