Répondre à la discussion
Affichage des résultats 1 à 15 sur 15

Exercice sur les brins dans L'ADN



  1. #1
    Margot41

    Cool Exercice sur les brins dans L'ADN


    ------

    Salut !
    Voila j'ai un exercice sur L'ADN-l'ARNm mais j'ai pas compris grand chose ! J'ai essayé de faire quelques trucs mais j'aimrerai comparer avec vos réponses !

    ex:
    Soit une protéine humaine composée de 302 a.a. ON a isolé une fragment d'ADN contenant le début de la phase codante du gène correspondant:

    GGTATGATCCAGCAAACCTATCGATGTAAC AACTCCGCAGCTAGGCATAACG
    CCATACTAGGACGTTTGGATTGCTACATTG TTGAGGCGTCGATCCGTATTGC

    Questions:
    1. Identifiez le début de la phase codante du gène.
    Quel est le brin d'ADN porteur de l'information génétique responsable de la formation de la protéine?

    2.Ecrivez la séquence nucléotidique du fragment d'ARNm codant pour le début de la protéine.

    3. Déduisez, grâce au code génétique ,le début de la séquence de la protéine.

    4.On a isolé une protéine mutante dans laquelle la première sérine est remplacée par une arginine.
    Quelles mutations nucléotidiques rendent compte de ce changement d'a.a ?

    5. Dans une pathologie, on trouve une forme écourtée de la protéine: seuls les trois premiers a.a sont présents.
    Quelle mutation nucléotidique peut-on prédire ?

    Merci à tous ceux qui prendront le temps de le lire et de le faire!

    -----

  2. Publicité
  3. #2
    lazyboy

    Re : Exercice sur les brins dans L'ADN

    1) Demande toi quel est l'acide aminé qui initie la traduction de l'ARNm ? Tu remontes au triplet de nucléotide sur l'ARNm puis au triplet de nucléotide sur l'un des bruns de l'ADN. Tu trouveras le début de la séquence codante, et le brin codant.

    2) Je pense que tu devrais y arriver avec ton cours

    3) Idem

    4) Une mutation qui remplace un acide aminé par un autre est appellée comment ? (l'acide aminé est de nature différente)

    5) Une mutation qui tronque la chaine polypeptidique est appellé comment ?

    Je pense que toutes les réponses sont dans ton cours, alors dis nous ce que tu as écris, et on te dira si tu vises juste

  4. #3
    Margot41

    Re : Exercice sur les brins dans L'ADN

    J'ai écrit: (je pense pas grand chose de juste)
    1) le début de la phase codante du gène est: CCATACTAG... C'est le brin codant qui est porteur de l'info génétique
    2) la séquence nucléotide du fragement d'ARNm: GGUAUGAUCCUGCAAACCUAACGAUGT...
    3)Gly-MET-Ile-Leu-Gln-Thr-STOP
    4) j'ai pas trouvé
    5) j'ai rien trouvé non plus ..

    Merci pour votre aide !

  5. #4
    Guillaume69

    Re : Exercice sur les brins dans L'ADN

    Bonsoir

    Pour la première question, il me semble qu'on demande quel brin est responsable de la formation de la protéine. Je répondrais donc qu'il s'agit de celui qui est transcrit : le brin matrice, et non le brin codant.

    D'accord avec lazyboy pour la 2 et la 3. En remplacant la thymine par l'uracile, et en sachant lire le tableau du code génétique, c'est juste.

    Pour les deux dernieres questions, ce n'est que du vocabulaire à connaître. Ca devrait être dans ton cours. Si ce n'est pas le cas, regarde dans ton livre, ou fais une rapide recherche sur google, ça se trouve facilement.

    Bonne soirée

  6. #5
    lazyboy

    Re : Exercice sur les brins dans L'ADN

    Non je pense vraiment qu'il s'agit d'identifier le brin codant non? La question n'est pas précise aussi...

    Margot, si tu as appris ton cours, il doit être marqué que:
    la traduction d'un ARNm n'estn initiée qu'à partir d'un triplet de nucléotides codant pour la Methionine! Donc ton polypeptide ne peut commencer que par l'acide aminé Methionine! (En réalité, cet acide aminé est souvent clivé dans la protéine finale)
    La question que tu dois te poser est donc: quel est le triplet qui code pour la Met sur l'ARNm ? Cet ARNm ayant été transcrit à partir d'un des brins de l'ADN, tu dois pouvoir retrouver le codon sur l'ADN correspondant! Et ainsi, tu identifieras le brin transcrit! Le brin codant est donc l'autre brin, son complémentaire...

    A toi de jouer!

  7. A voir en vidéo sur Futura
  8. #6
    lazyboy

    Re : Exercice sur les brins dans L'ADN

    Bon allez, je te donne un indice:
    le codon sur l'ARNm qui est à l'origine de la MET est: AUG
    le codon sur le brin d'ADN transcrit est donc: TAC (en effet: T->A, A->U, C->G)
    le codon sur le brin d'ADN non transcrit, c'est-à-dire, codant, est donc: ATG!
    A toi de chercher le 1er codon ATG sur l'une des séquence d'ADN, et tu trouveras:
    -le brin codant
    -le début de la partie codante pour la protéine!

    Ensuite, tu prends chaque triplet de nucléotide du brin transcrit, et tu écris les nucléotides complémentaires, pour T c'est A, pour G c'est C, pour C c'est G, pour A c'est U (et non T!).
    Tu obtiens ta séquence d'ARNm, et tu la traduits avec ton code génétique, en prenant chaque triplet de nucléotides que tu remplaces par un acide aminé.
    Tu fais cela jusqu'à que tu arrives sur un codon STOP, qui peut être codé par plusieurs triplets de nucléotides, c'est la fin de ta protéine.

    Dis nous ce que tu as trouvé

  9. Publicité
  10. #7
    Guillaume69

    Re : Exercice sur les brins dans L'ADN

    Salut

    Citation Envoyé par lazyboy Voir le message
    Non je pense vraiment qu'il s'agit d'identifier le brin codant non? La question n'est pas précise aussi...
    Je suis d'accord : la question n'est pas super bien formulée.
    Mais le brin qui "porte l'information responsable de la formation" est le brin matrice.

  11. #8
    Margot41

    Re : Exercice sur les brins dans L'ADN

    Je ne comprends pas, le brin responsable de la formation de la protéine est donc le brin transcrit ou le brin codant ?

  12. #9
    Guillaume69

    Re : Exercice sur les brins dans L'ADN

    Bonsoir

    Le brin transcrit (ou le brin matrice) est le brin d'ADN à partir duquel la transcription est effectuée. l'ARNm est produit à partir de ce brin, et possède les nucléotides complémentaires de ce dernier (sauf T remplacé par U).
    Comme il est responsable de la formation de l'ARNm, qui lui même est responsable de la formation d'une protéine : il est donc responsable de la formation de la protéine.

    L'autre brin, le brin codant, n'est pas transcrit. Il n'est pas responsable de la formation d'un ARNm, donc pas responsable de la formation d'une protéine.

  13. #10
    Margot41

    Re : Exercice sur les brins dans L'ADN

    Ah oui ok, J'ai tout compris merci pour cette explication très claire
    Tu devrais faire prof XD

  14. #11
    oce11

    Re : Exercice sur les brins dans L'ADN

    bonjour ! moi j'ai le même exercice à faire! j'ai tout compris grâce à vos explications mais je ne trouve pas la réponse à la question 5! Pouvez vous m'aider svp?!

  15. #12
    Moumoutte

    Re : Exercice sur les brins dans L'ADN

    Bonjour,

    regarde donc dans ton cours comment s'appelle une mutation qui remplace le codon d'un acide aminé par un codon STOP (la protéine est donc écourtée), ça m'étonnerai que vous ne l'ayez pas vu si on vous propose ce genre d'exercices.
    Si vraiment tu n'as aucune proposition à faire, nous t'aiderons davantage

    Codialement

  16. Publicité
  17. #13
    oce11

    Re : Exercice sur les brins dans L'ADN

    j'ai regardé dans mon cours et il n'y a rien ! Et dans mon livre il y a tellement de trucs et c'est super compliqué que je n'arrive pas non plus à trouver

    Pouvez-vous me donner plus d'informations svp ?


  18. #14
    Moumoutte

    Re : Exercice sur les brins dans L'ADN

    Re-bonjour,

    et bien si une protéine est tronquée cela peut venir de deux types de mutations:

    - une substitution d'un nucléotide par un autre qui conduit à l'apparition d'un codon STOP à la place de celui de l'acide aminé. C'est ce qu'on appelle une mutation non-sens.
    - ou alors il peut s'agir d'une insertion ou délétion de nucléotides qui décalent donc le cadre de lecture et peuvent conduire à l'apparition d'un codon STOP prématuré

    Cordialement

  19. #15
    oce11

    Re : Exercice sur les brins dans L'ADN

    merci beaucoup moumoutte !!

Sur le même thème :

Discussions similaires

  1. Exercice Sur Les Transformation Dans Le Plan 2nd
    Par missdauphine dans le forum Mathématiques du collège et du lycée
    Réponses: 9
    Dernier message: 23/04/2008, 17h31
  2. Actu - Serge Martin : « Les briques de l'ADN pourraient se former dans l'espace »
    Par RSSBot dans le forum Commentez les actus, dossiers et définitions
    Réponses: 2
    Dernier message: 17/10/2007, 07h44
  3. Pb sur un exercice sur l'ADN
    Par adher01 dans le forum Biologie
    Réponses: 4
    Dernier message: 20/04/2007, 09h31
  4. De l'ADN immortel dans les cellules souches musculaires
    Par RSSBot dans le forum Commentez les actus, dossiers et définitions
    Réponses: 0
    Dernier message: 30/06/2006, 13h27
  5. Explications sur l'ADN et les chromosomes
    Par Pierre-Yves dans le forum Biologie
    Réponses: 5
    Dernier message: 29/03/2005, 21h18