Répondre à la discussion
Affichage des résultats 1 à 8 sur 8

Exercice



  1. #1
    poopo

    Exercice


    ------

    slt a tous voila j'ai un exercice a faire mais je n'arrive pas assez

    allele1:ATGGTGCACCTGACTCCTGAG

    alllel2:ATGGTGCATCTGACTCCTGAG

    allele3: ATGGTGCACCTGACACCTGAG

    allele4:ATGGTGCACCTGACTCCTGTG

    allele5:ATGGTGCACCTGACTCCTAAG

    allele6:ATGGTGCACCTAACTCCTGAG


    voila

    la premier question est

    1)trouvez un critere de classement des different alléles
    j'ai mis allele avec mutation et sans consequence pour les alleles 1 2 3 et 6et allele avec mutation qui entraine une modification au niveau des AA pour les alleles 4 et 5


    2)trouvez un critere de classement des different sequence en polypeptides
    j'ai mis sequence sans mutation pour les alles 1 2 3 et 6
    et sequence avec mutation pour les alleles 4 et 5


    et la question 3 je n'y arrive pas

    3)a partir de ces reponses vous montrez que le code genetique est tel que lors de la synthese des proteines certaine erreurs de lecteure (celles concernant le troisieme nucleotide d'un codon)peuvent etre sans consequence

    merci d'avance

    -----

  2. Publicité
  3. #2
    Minon

    Re : Exercice

    A mon avis tu devrais parler de phénotype et génotype: ça sera plus clair pour toi et pour tes lecteurs... et pour la réponse à ta troisième question tu la donnes dès ta première réponse!! Indice : pense à la redondance du code génétique

  4. #3
    poopo

    Re : Exercice

    dsl j'ai beau cherhcer a comprendre mais je n'y arrive pas a la question 3

  5. #4
    Minon

    Re : Exercice

    Je te conseille de prendre un code génétique et de faire des comparaisons entre les codons et les aa que tu obtiens. Regarde les différences obtenues lorsque tu fais varier uniquement le dernier nucléotide dans un codon

  6. #5
    poopo

    Re : Exercice

    je vois que sa change rien on obtient les meme acide aminés nn?

  7. A voir en vidéo sur Futura
  8. #6
    Minon

    Re : Exercice

    Voilà c'est ça! En fait on dit que le code génétique est dégénéré ou redondant: plusieurs codons différents codent pour le même acide aminé. La plupart du temps la différence est sur le dernier nucléotide du codon. Du coup s'il y a une erreur de lecture lors de la synthèse de ta protéine et que cette erreur a lieu sur le dernier nucléotide, tu peux avoir le bon acide aminé mit en place tout de même et donc avoir une protéine active.

  9. Publicité
  10. #7
    poopo

    Re : Exercice

    a d'accord c'est tout lol mais sinon mes criteres il sont juste?

    et en parlent de sa es que tu peux passer sur mon autre forum stp?

  11. #8
    Minon

    Re : Exercice

    Pour les critères je ne peux pas te dire avec certitudes que c'est ce qui est attendu. Pour ton autre problème je t'ai répondu par message privé.

Sur le même thème :

Discussions similaires

  1. exercice
    Par The J-L dans le forum Chimie
    Réponses: 3
    Dernier message: 04/11/2008, 17h31
  2. [Biochimie] exercice
    Par oui2 dans le forum Biologie
    Réponses: 1
    Dernier message: 27/10/2008, 15h10
  3. exercice TS
    Par taka31 dans le forum Mathématiques du collège et du lycée
    Réponses: 7
    Dernier message: 27/09/2008, 16h44
  4. exercice
    Par jeune chimiste dans le forum Chimie
    Réponses: 3
    Dernier message: 15/07/2008, 10h37
  5. Exercice
    Par nitro74 dans le forum Physique
    Réponses: 29
    Dernier message: 17/11/2006, 22h16