Répondre à la discussion
Affichage des résultats 1 à 3 sur 3

Polymorphisme???



  1. #1
    amandine57

    Question Polymorphisme???

    Bonjour à tous! Voilà j'ai un peu de mal à comprendre la notion de polymorphisme... Je sais qu'a l'échelle d'une population, un gène est considéré comme polymorphe s'il possède au moins deux allèles dont la fréquence est supérieure à 1 %. Mais qu'est-ce que le polymorphisme individuel????

    -----


  2. #2
    Istria

    Re : Polymorphisme???

    Un exemple:

    Tu as un gène par exemple CYP2D6 ce gène une fois traduit en protéine à une fonction ( il détoxifie des médicaments entre autre).

    1. Mais en réalité dans la population humaine tu as différents CYP2D6

    Car dans le concrêt un gène c’est ca! ( suite en dessous de cette affreuse suite de lettre)

    >chromosome:NCBI36:22:40852345 :40856952:-1
    GCAGCCCATACCCGCCCTGGCCTGACTCTG CCACTGGCARCACAGTCAACACAGCAGGTT
    CACTCACAGCAGAGGGCAAAGGCCATCATC AGCTCCCTTTATAAGGGAAGGGTCACGCGC
    TCGGTGTGCTGAGAGTGTCCTGCCTGGTCC TCTGTGCCTGGTGGGGTGGGGGTGCCAGGT
    GTGTCCAGAGGAGCCCATTTGGTAGTGAGG CAGGTATGGGGCTAGAAGCACTGGTGCCCC
    TGGCCRTGATAGTGGCCATCTTCCTGCTCC TGGTGGACCTGATGCACCGGCRCCAACGMT
    GGGCTGCACGCTACYCACCAGGCCCCCTGC CACTGCCCRGGCTGGGCAACCTGCTGCATG
    TGGACTTCCAGAACACACCATACTGCTTCG ACCAGGTGAGGGAGGAGGTCCTGGAGGGCG
    GCAGAGGTSCTGAGGMTGCCCCACCACCAG CAAACATGGGTGGTGGGTGAAACCACAGGC
    TGGACCAGAAGCCAGGCTGAGAAGGGGAAG CAGGTTTGGGGGACKTCCTGGRGAAGGRCA
    TTTATACATGGCATGAAGGACTGGATTTTC CAAAGGCCAAGGAAGAGTAGGGCAAGGGCC
    TGGAGGTGGAGCTGGACTTGGCAGTGGGCA TGCAAGCCCATTGGGCAACATATGTTATGG
    AGTACAAAGTCCCTTCTGCTGACACCAGAA GGAAAGGCCTTGGGAATGGAAGATGAGTTA
    GTCCTGAGTGCCGTTTAAATCACGAAATCG AGGATGAAGGGGGTGCAGTGACCCGGTTCA
    AACCTTTTGCACTGTGGGTCCTCGGGCCTC ACTGCTCACCGGCATGGACCATCATCTGGG
    AATGGGATGCTAACTGGGGCCTCTCGGCAA TTTTGGTGACTCTTGCAAGGTCATACCTGG
    GTGACGCATCCAAACTGAGTTCCTCCATCA CAGAAGGTGTGAMCCCCACCCCYGCCCCAG
    GATCAGGAGGCTGGGTCTCCTCCTTCCACC TGCTCACTCCTGGTAGCCCCGGGGGTCGTC
    CAAGGTTCAAATAGGACTAGGACCTGTAGT CTGGGGGGATCCTGGCTTGACAAGAGGCCC
    TGACCCTCCCTCTGCASTTGCGGCGCCGCT TCGGGGACGTGTTCAGCCTGCAGCTGGCCT
    GGACGCCGGTGGTCGTGCTCAATGGGCTGG CGGCCGTGCGCGAGGCGMTGGTGACCCRCG
    GCGAGGACACSGCCGACCGCCCGCCTGTGC CCATCAYCCAGATCCTGGGYTTYGGGCCGC
    GTTCCCAAGGCAAGCAGCGGTGGGGACAGA GACAGATTTCCGTGGGACCCGGGTGGGTGA
    TGACCGTAGTCCGAGCTGGGCAGAGAGGGC GCGGGGTYGTGGACATGAAACAGGCCAGCG
    AGTRGGGACAGCGGGCCAAGAAACCACCTG CACTAGGGAGGTGTGAGCATGGGGACGAGG
    GCGGGGCTTGTGACGAGTGGGCGGGGCCAC TGCCGAGACCTGGCAGGAGCCCAATGGGTG
    AGGCTGGCGCATTTCCCAGCTGGAATCCGG TGTCGAAGTGGGGGGCGGGGACCGCACCTG
    TGCTGTAAGCTCAGTGTGGGTGGCGCGGGG CCCGCGGGGTCTTCCCTGAGTGCAAAGGCG
    GTCAGGGTGGGCAGAGACGAGGTGGGGCAA AGCCCTGCCCCAGCCAAGGGAGCAAGGTGG
    ATGCACAAAGAGTGGGCCCTGTGACCAGCT GGACAGAGCCAGGGACTGCGGGAGACCAGG
    GGGAGCATAGGGTTGGAGTGGGTGGTGGAT GGTGGGGCTAATGCCTTCATGGCCACGCGC
    ACGTGCCCGTCCCACCCCCAGGGGTGWTCC TGKCGCGCTATGGGCCCGCGTGGCGCGAGC
    AGAGGCGCTTCTCCGTCTCCACCTTGCGCA ACTTGGGCCTGGGCAAGAAGTCGCTGGAGC
    AGTGGGTGACCRAGGAGGCCGCCTGCCTTT GTGCCGCCTTCGCCRACCAMKCCKGTGGGT
    GATGGGCAGAAGGGCACAAAGCGGGAACTG GGAAGGCGGGGGACGGRGAAGGMRACCCCT
    TACCCGCATCTCCCACCCCCAGGACGCCCC TTTCGCCCCAACGGYCTCTTGGACAAAGCC
    GTGAGCAACGTGATCGCCTCCCTCACCTGC GGGCGCCGYTTCGAGTACGACGACCCTCGC
    TTCCTCAGGCTGCTGGACCTAGCTCAGGAG GRAYYGAAGGAGGAGTCGGGCTTYCTGCGC
    GAGGTGCGGAGCGAGAGACCGAGGAGTCTY TGCAGGGCGAGCTCCYGAGAGGTGCCGGGG
    CTGGAYTGGGGCCTCSGAAGRGCAGGATTT GCATAGATGGGTTTGGGAAAGGACATTCCA
    GGAGACCCCACTGTAAGAAGGGCCTGGAGG AGGAGGGGACATCTCAGACATGGTYGTGGG
    AGAGGTGTGCCCGGGTCAGGGGGCACCAGG AGAGGCCAAGGACTCTGTACCYCCTATCCA
    CGTYRGAGATTTCGATTTTAGGTYTCTCCT CTGGGCAAGGAGAGAGGGTGGAGGCTGGYA
    CTTGGGGAGGGACTTGGTGAGGTCAGTGGT AAGGACAGGCAGGCCCTGGGTCTACCTGGA
    GATGGCTGGGGCCTGAGACTKGTCCAGRTG AACGCAGAGCACAGGAGGGATTGAGACCCC
    GTTCTGTCTGGTGTAGGTGCTGAATGCTGT CCCCGTCCTCCYGCAYATCCCAGCGCTGKC
    TGGCAAGGTCCTACGCTTCCAAAAGGCTTT CCTGACCCAGCTGGATGAGCTGCTAACTGA
    GCACAGGATGACCTGGGACCCAGCCCAGCC CCCCCGAGACCTGACTGAGGCCTTCCTKGC
    AGAGAWGGAGAAGGTGAGAGTGGCTGCCAC GGTGGGGGGCAAGGGTGGTGGGTTGARCRT
    CCCAGGAGGAATGAGGGGAGGCTGGGCAAA AGGTTGGACCAGTGCATCACCCGGCGAGCC
    GCATCTGGGCTGACAGGTGCAGAATTGGAG GTCATWTGGGGGCTACCCCGTTCTGTCCCG
    AGTATGCTCTCGGCCCTGCTCAGGCCAAGG GGARCCCTGAGAGCAGCTTCAATGATGAGA
    ACSTGYGCATAGTGGTGGSTRACCTGTTCT CTGCCGGGATGGTGACCACCTYGACCACGC
    TGGCCTGGGGCCTCCTGCTCATGATCCTAC MYCCGGATGTGCAGCGTGAGCCCATCTGGG
    AAACAGTGCAGGGGCCGAGGGAGRAAGGGT ACAGGCGGGGGCCCATGAACTTTGCTGGGA
    CACCCGGGGCTCCAAGCACAGGCTTGACCA GGATCCTGTAAGCCTGACCTCCTCCAACAT
    AGGAGGCAAGAAGGAGTGTCAGGGCCGGAC CCCCTGGGTGCTGACCCATTGTGGGGACGC
    ATGTCTGTCCAGKCCGTGTCCAACAGGAGA TCGACGACRTGATAGGGCAGGTGCGGCGAC
    CAGAGATGGGTGACCAGGCTCACATGCCCT ACACCACTGCCGTGATTCAYGAGGTGCAGC
    RCTTTGGGGACATCRTCCCCCTGRGTRTGA CCCATATGACATCCCRTGACATCGAAGTAC
    AGGGCTTCCGCATCCCTAAGGTAGGCCTGG CGCCCTCCTCACCCCAGCTCAGCACCAGCC
    CCTGGTGRYAGCCCCAGCATGGCYACTGCC AGGTGGGCCCACTCTAGGAAMCCTGGCCAC
    CTAGTCCTCAATGCCACCACACTGACTGTC CCCACTTGGGTGGGGGGTCCAGAGTATAGG
    CAGGGCTGGCCTGTCCATCCAGAGCCCCCG TCTAGTGGGGAGACAAAYCAGGACCTGCCA
    GAATGTTGGAGGACCCARCRCCTGCAGGGA GAGGGGGCAGTGTGGGTGCCTCTGAGAGGT
    GTGACTGCGCCCTGCTGTGGGGTCGGAGAG GGTACTGTGGAGCTTCTCGGGCGCAGGACT
    AGTTGACAGAGTCCAGCTGTGTGCCAGGCA GTGTGTGTCCCCCGTGTGTTTGGTGGCAGG
    GGTCCCAGCATCCTAGAGTCCAGTCCCCAC TCTCACCCTGCATCTYCTGCCCAGGGAACG
    ACACTCATCACCAACCTGTCATCRGTGCTG AAGGATGAGGCCGTCTGGGAGAAGCCCTTC
    CGCTTCCACCCCRAACACTTCCTGGATGCC CAGGGCCACTTTGTGAAGCYGGAGGCCTTC
    CTGCCTTTCTCAGCAGGTGCCTGTGGGGAG CCCGGCTCCCTGTCCCCTTCCGTGGAGTCT
    TGCAGGGGTATCACCCAGGAGCCAGGCTCA CTGACGCCCCTCCCCTCCCCACAGGCCGCC
    GTGCATGCCTCGGGGAGCCCCTGGCCCGCA TGGAGCTCTTCCTCTTCTTCACCTCCCTGC
    TGCAGCACTTCAGCTTCTCSGTGSCCRCYG GACAGCCCCGGCCCAGCCACYATSGTGTCK
    TYGCTTTYCTGGTGASCCCATCCCCCTATG AGCTTTGTGCTGTGCCCCGCTAGAATGGGG
    TACCTAGTCCCCAGCCTGCTCCCTAGCCAG AGGCTCTAATGTACAATAAAGCAATGTGGT
    AGTTCCAACTCGGGTCCCCTGCTCACGCCC TCGTTGGGATCATCYTCCTCAGGGCAACCC
    CACCCCTGCCTCATTCCTGCTTACCCCACC GCCTGGCCGCATTTGAGA

    Si tu changes une de ces lettres (mutation) tu ne changes pas forcément le fonctionnement du gène mais parfois ca peut tous changer, soit détruire la fonction du gène sont modifier son activité.

    En gros un gène CYP2D6 peut détoxifier tr`s vite et un autre très lentement voir pas du tout.

    2. Le second facteur du polymorphisme est le nombre d’un même gène que tu possèdes. Un même chromosome peut porter de 0 CYP2D6 à bien plus.

    J ai été +/- clair?

  3. #3
    Katie20012

    Re : Polymorphisme???

    Un polymorphisme génétique (du grec "poly" plusieurs et "morphos" formes) est le fait qu'une espèce présente différents types au sein d'une même population.
    Ce sont des variations liées aux mutations génétiques et aux différentes adaptations. Cela correspond par exemple aux mimétismes de formes des papillons et de certaines formes de mites, les motifs sur les coquilles d'escargot, les groupes sanguins humains et de nombreux autres cas.
    D'ailleurs voici un site qui j'espère te sera utile:
    http://www.med.univ-rennes1.fr/respe...ymorphisme.pdf
    Cordialement,
    Katie.

Sur le même thème :

Discussions similaires

  1. [Génétique] polymorphisme genetique
    Par AZER_REX dans le forum Biologie
    Réponses: 5
    Dernier message: 23/07/2009, 10h11
  2. [Divers] notion de polymorphisme
    Par jade40 dans le forum Biologie
    Réponses: 5
    Dernier message: 18/12/2008, 19h17
  3. [Biologie Moléculaire] Polymorphisme génétique
    Par messiva dans le forum Biologie
    Réponses: 7
    Dernier message: 03/09/2008, 15h05
  4. [Génétique] Polyalléllisme et polymorphisme
    Par fab4555 dans le forum Biologie
    Réponses: 1
    Dernier message: 03/04/2008, 22h43
  5. [Génétique] polymorphisme
    Par marmotte412 dans le forum Biologie
    Réponses: 4
    Dernier message: 11/12/2007, 15h31