Répondre à la discussion
Affichage des résultats 1 à 12 sur 12

Amplification par PCR




  1. #1
    droitObut

    Amplification par PCR

    Bonjours à tous, j'ai besoin d'aide pour un petit exercice, si quelqu'un pouvait m'aidé à commençer, Merci d'avance!

    Voilà l'énoncé:
    Dessiner les amorces sens et reverse qui permettront d’amplifier par PCR le gène
    DVU0695 ci-dessous.
    GTGGCACTGCTTACATTCCATGCCAGCATC ATTGACATGGACCTTGTGGCTGAAC
    CGGATCGGCTGTTCTTTCTGGCTGTAGAGC ATTTCCGGGAATGCCCACCAACCGA
    AGACCAGCGCGACGACCAGGCCGACGAAGA ACGGCGCTGCGCCACCACATGCGC
    ATTTGCGACCGTTTTCGTTGTCTGCATTGG TTAA

    -----


  2. Publicité
  3. #2
    stonekiller

    Re : Amplification par PCR

    Ce n'est vraiment pas compliqué si tu as compris le principe d'une PCR, désolé mais t'aider plus que ca sans faire l'exercice, c'est impossible!
    Revoie étape par étape en quoi consiste la PCR tu comprendras très vite

    En revanche si certaine étapes t'échappe n'hésite pas à nus en faire part!

  4. #3
    droitObut

    Re : Amplification par PCR

    Bien sûre ce serait inutile de me faire l'exercice! je pensais à :

    Pour l'amorce up: XXXXCACCGT et pour la down: XXXXAATTGG


    Mais faut-il que l'amorce commence uniquement à l'ATG jusqu'au STOP ou bien comme j'ai fait?



    Merci de votre aide!


  5. #4
    stonekiller

    Re : Amplification par PCR

    Que signifie ton x (il n'existe pas dans le code international). Si tu cherches juste à amplifier ton gène, il est inutile de commence ton dessin d'amorce par un ATG et de même il n'est pas nécessaire de finir par un stop. Apres évidement si tu souhaites les utiliser sur ADNc la oui il vaut mieux qu'ils soient fait sur la phase codante!

  6. #5
    droitObut

    Re : Amplification par PCR

    En fait à la place des X, ce sont des nucléotides, peut importe lesquels du moment qu'il ne sont pas complémentaire d'une partie de ma sequence, qu'en pensez-vous?

  7. A voir en vidéo sur Futura
  8. #6
    404BlueJack

    Re : Amplification par PCR

    J'ai le même problème que lui et je ne sais pas trouvé des amorces.
    La procédure qu'on a nous dit pas comment faire.
    Y'a des impulsifs qui téléphonent, y'en a d'autres qui se déplacent.

  9. #7
    piwi

    Re : Amplification par PCR

    Un petit dessin valant mieux qu'un long discours, en voici un.
    Les couleurs soutenues (rouges et vertes représentent les amorces). La convention veut que l'on ne décrive une séquence d'ADN qu'en n'explicitant que le brin 5'-3'.
    Ceci étant dit. Si l'amorce sens est complémentaire au brin 3'-5', alors que peut on dire de sa séquence par rapport au brin 5'-3'? Une fois ceci bien compris, comment trouver l'amorce reverse grâce au seul brin 5'-3'?

    5' -------------------------->3'
    3'<---------------------------5'

    5' -------------------------->3'
    --- <---------------- <----


    --- ---->----------------->
    3'<---------------------------5'

    Par ailleurs, Pourquoi voulez vous créer des amorces qui ne soient pas entièrement spécifiques du fragment d'ADN que vous souhaitez amplifier? La probabilité de rencontrer une base est de 1/4, celle de rencontrer deux bases précises est de 1/4; 3 bases, 1/8 etc... Quelle est la probabilité de rencontrer 6 bases? Est-ce fréquent dans un génome de 3.109 pb? La longueur d'identité de vos amorces par rapport au fragment cible n'est elle pas un moyen d'augmenter la spécificité d'amplification?

    Cordialement,
    piwi
    Je sers la science et c'est ma joie.... Il parait.

  10. Publicité
  11. #8
    droitObut

    Re : Amplification par PCR

    "La convention veut que l'on ne décrive une séquence d'ADN qu'en n'explicitant que le brin 5'-3'.
    Ceci étant dit. Si l'amorce sens est complémentaire au brin 3'-5', alors que peut on dire de sa séquence par rapport au brin 5'-3'? Une fois ceci bien compris, comment trouver l'amorce reverse grâce au seul brin 5'-3'? "


    L'amorce sens sera donc identique au brin 5'-3', et pour l'amorce reverse je bloque un peu...

    Quant à la longueur des amorces on peut les choisir aussi longues que l'on veut pour augmenter la spécificité donc.

  12. #9
    droitObut

    Re : Amplification par PCR

    UP svp c'est très important

  13. #10
    stonekiller

    Re : Amplification par PCR

    Regarde cette animation elle bien faite:

    http://www.ens-lyon.fr/RELIE/PCR/pri...esentation.htm

    n'oublie pas que la taq amplifie de 5' vers 3'. Je te conseil de dessiner étape par étape ce qui se passe lors de la réaction PCR ca t'aidera vraiment à comprendre le principe.

  14. #11
    droitObut

    Re : Amplification par PCR

    ok (pas mal l'animation)

    je dirais, pour l'amorce up: 5'GTGGCAC3'
    et pour la down: 5'AATTGG3'

    (en les prenant plus longues pour augmenter la spécificité)

  15. #12
    stonekiller

    Re : Amplification par PCR


    Mais en réalité les primers sont généralement bien plus long que ca ! (20 pb en moyenne)

Discussions similaires

  1. [Biologie Moléculaire] Amplification PCR
    Par stonekiller dans le forum Biologie
    Réponses: 3
    Dernier message: 01/08/2009, 23h57
  2. Amplification des ondes radio par cactus
    Par Narfcois dans le forum Physique
    Réponses: 2
    Dernier message: 05/04/2008, 21h52
  3. Garder le signal positif après amplification par transistor
    Par Olivier_34 dans le forum Électronique
    Réponses: 17
    Dernier message: 02/11/2007, 20h34
  4. PCR (amplification génique)
    Par miukychan dans le forum Biologie
    Réponses: 3
    Dernier message: 05/05/2007, 17h40
  5. [Help]Plan amplification d'un signal electronique par résistance
    Par tashikoma dans le forum Électronique
    Réponses: 3
    Dernier message: 13/11/2006, 18h42