Répondre à la discussion
Affichage des résultats 1 à 10 sur 10

ARNm Bactérien.



  1. #1
    bidoo

    ARNm Bactérien.


    ------

    Bonjour,
    Alors, mon problème et que j'aimerai comprendre comme différencier les séquences d'ARN bactériens et les ARN Eucaryotes.

    J'ai un exemple concret : 5 séquences, lequel est un ARNm Bactérien ?

    1) 5' AGCACAGGUCCUUGACCUAUGGCGAAGACA UUCGGAUAG 3'
    2) 5' ACCACCCUGUGGGACCUAUGGCGUCUAUCG AUAGAUAA 3'
    3) 5' AGCACAGGAGGUUUGACCUAUGGCUUCUAC CGAAAGAUAA 3'
    4) 5' GGCACAGCAGUUUUGACCUAUGCCUACGAC CGACAGAUAA 3'
    5) 5' UGGACACCAGCCUUGACCUAUGUUUUCUCC GACAAGAUAA 3'

    Pfioou !
    Et merci

    -----

  2. Publicité
  3. #2
    LXR

    Re : ARNm Bactérien.

    Bonjour,

    A priori, on ne peut les discerner qu'en repérant des séquences qui n'ont d'utilité que chez l'eucaryote. Mais ce n'est pas un critère absolu, loin de là, ces séquences peuvent très bien être présentes chez les procaryotes même si elles n'ont aucune utilité. Le mieux pour savoir si un ARNm appartient à un eucaryote ou un procaryote, c'est de faire un blast sur l'ARNm inconnu.

    Dans le cadre d'un exercice comme ici, les choses sont simplifiées et volontairement ciblées. On voit que les ARNm 2, 3, 4 et 5 ont vers leur extrémité 3' une séquence (AGAUAA) que ne possède pas l'ARNm 1. La poly(A) polymérase qui est une enzyme synthétisant la queue polyA chez l'eucaryote (les ARNm procaryotes n'ont pas de queue polyA) reconnait une séquence consensus AAUAAA, similaire à la séquence que nous retrouvons dans ton exercice. Je suppose donc que l'ARNm procaryote est le 1, et tous les autres sont eucaryotes, mais je dis ça sans garantie...

  4. #3
    bidoo

    Re : ARNm Bactérien.

    Il faudrai donc chercher, pour des exercices de ce type, une séquence (Ici AGAUAA), présente dans tous les ARNm sauf un.
    Le problème c'est que les séquences (UGA CCU AUG) sont présentes sur les ARNm 1,3,4,5. Je doit donc connaitre une liste de séquence non utilisé par les procaryotes ?


    Merci de ton aide LXR !

  5. #4
    Flyingbike
    Modérateur

    Re : ARNm Bactérien.

    LXR est moins naïf que moi qui ait essayé de blaster ces séquences dans tous les sens sans rien en sortir. Ce sont des séquences imaginaires d'exercice de bio !

  6. A voir en vidéo sur Futura
  7. #5
    LXR

    Re : ARNm Bactérien.

    Citation Envoyé par Flyingbike Voir le message
    Ce sont des séquences imaginaires d'exercice de bio !
    J'ai été passablement rodé avec ce genre de mauvaise blague dans les exercices de bio mol que j'ai eu à la fac!

    Il faudrai donc chercher, pour des exercices de ce type, une séquence (Ici AGAUAA), présente dans tous les ARNm sauf un.
    Ca dépend de l'exercice, s'il faut dans un autre exo, tu auras 1 ARNm procaryote et un autre eucaryote. Je pense que le but de l'exercice est de te faire repérer des séquence consensus que l'on t'a appris dans tes cours. Ces séquences consensus peuvent être spécifique d'un domaine phylogénétique (proca vs euca) mais pas toutes. La boite TATAA par exemple est présente dans ces deux domaines. Le problème des séquences consensus est qu'elles sont rarement identiques au consensus, il faut donc les identifier par ressemblance.

    Je ne connais pas ton niveau mais en principe, on n'apprend pas plus de 3 séquences consensus sur un gène eucaryote: la TATAA Box, le terminateur de transcription (qui est plutôt une structure secondaire repérée par ses répétitions de G et C complémentaires) et la séquence de polyadénylation.
    Dernière modification par LXR ; 04/05/2010 à 15h46.

  8. #6
    gorben

    Re : ARNm Bactérien.

    initialement j'avais pense a regarder le %GC des sequences, vu que les eucaryotes ont generalement un GC eleve / aux procaryotes, mais apparement l'exo est mal fait vu que les %GC sont tous aux alentours de 40-50%...

  9. Publicité
  10. #7
    Flyingbike
    Modérateur

    Re : ARNm Bactérien.

    et puis un %GC sur une séquence de 30bp, je ne pense pas que cela suffise pour trancher...

  11. #8
    huseyin67

    Re : ARNm Bactérien.

    Bonjour, alors il faut tout simplement retrouver la région dite shine dalgarno , qui est en amont de 8 base du codon initiateur AUG, chez les bacteries qui est en général "AGGAGG", voilà .
    chez toi c'est celui ci : 3)
    5' AGCACAGGAGGUUUGACCUAUGGCUUCUAC CGAAAGAUAA 3'

  12. #9
    LXR

    Re : ARNm Bactérien.

    Même si cette réponse est tardive, je crois que là tu nous as tous calmé! En effet, cela semble être la bonne réponse...

  13. #10
    huseyin67

    Re : ARNm Bactérien.

    Oui je suis nouveau sur le forum , çà pourrait servir à quelqu'un d'autre .

Sur le même sujet


Discussions similaires

  1. [Microbiologie] Biotope bactérien
    Par laura59 dans le forum Biologie
    Réponses: 7
    Dernier message: 14/02/2010, 15h06
  2. [Microbiologie] Isolation ARNm bacterien
    Par pales dans le forum Biologie
    Réponses: 3
    Dernier message: 24/10/2009, 01h06
  3. [Biologie Moléculaire] promoteur bactérien
    Par hemoe dans le forum Biologie
    Réponses: 3
    Dernier message: 03/01/2008, 19h42
  4. genotype bactérien
    Par anth dans le forum Biologie
    Réponses: 2
    Dernier message: 28/05/2007, 14h25
  5. Le Lypopolysaccharide Bactérien
    Par Spliceosome dans le forum Biologie
    Réponses: 0
    Dernier message: 15/09/2004, 16h29
Découvrez nos comparatifs produits sur le sport et la santé.