Répondre à la discussion
Affichage des résultats 1 à 4 sur 4

ARNm bactérien



  1. #1
    Lsx

    ARNm bactérien

    Bonjour,

    Je n'arrive pas à résoudre l'exercice suivant car, d'après mes connaissances il faudrait trouver la séquence Shine Dalgarno (AGGAGG) pour trouver l'ARNm bactérien mais il y en a dans les séquences 1,3,4 et 5.
    Pourrait-on m'aider?

    Parmis les 5 séquences d'ARN listées ci-dessous, laquelle est celle d'un ARNm bactérien ?

    1) 5' AGCACAGGAGGUUUGACCUAUGCCUUCUUG AGAAUAA 3'
    2) 5' AGCACUUUUGGUUUGACCUAUGGCUUCUAC CGAAUAA 3'
    3) 5' AGCACAGGAGGUUUGACCUAUGGCUUCUAC CGAAUAA 3'
    4) 5' AGCACAGGAGGUUUGACCUAUGGCUUCUAC CGAAUUU 3'
    5) 5' AGCACAGGAGGUUUGACCUAUGGCUUCUAC CGAAUUU 3'

    Merci d'avance

    -----


  2. #2
    chamouulox

    Re : ARNm bactérien

    regarde dans la phase de ton aug initiateur,
    UAA stop ocre en 5eme codon sur les séquences 1,2,3

    apres pour 4 et 5... il me semble qu'elles sont identiques?

    cham,

  3. #3
    Lsx

    Re : ARNm bactérien

    Merci pour votre réponse mais concrètement je n'ai pas bien compris ce que vous vouliez dire?
    Pour les séquences 4 et 5 effectivement, ce sont les mêmes..

    Lsx

  4. #4
    chamouulox

    Re : ARNm bactérien

    Sur ton ARNm tu as un SD reconnu par le ribosome,

    la traduction est toujours démarrée par une méthionine (dans 95% des cas chez les bactéries en tout cas), qui est codée par un codon AUG quelques bases après le SD.

    En regardant dans la phase du AUG, c'est a dire en regardant les triplets de bases qui vont succéder à l'AUG, tu trouves dans les séquences 1, 2,3 un codon stop UAA très rapidement.
    Donc un ARNm qui ne coderait que pour 4 ou 5 acides aminés... Donc quelques chose qui n'a pas trop la tête d'un ARNm^^

    Cham,

Sur le même thème :

Discussions similaires

  1. [Microbiologie] Métabolisme bacterien
    Par yumyum031 dans le forum Biologie
    Réponses: 3
    Dernier message: 04/01/2013, 21h02
  2. Métabolisme bactérien
    Par elyaane dans le forum Exercices en biologie
    Réponses: 2
    Dernier message: 01/06/2011, 12h34
  3. [Biochimie] ARNm Bactérien.
    Par bidoo dans le forum Biologie
    Réponses: 9
    Dernier message: 10/05/2011, 12h29
  4. [Microbiologie] Biotope bactérien
    Par laura59 dans le forum Biologie
    Réponses: 7
    Dernier message: 14/02/2010, 14h06
  5. [Microbiologie] Isolation ARNm bacterien
    Par pales dans le forum Biologie
    Réponses: 3
    Dernier message: 24/10/2009, 00h06