Répondre à la discussion
Affichage des résultats 1 à 29 sur 29

probléme d'orientation des deux brins

  1. #1

    probléme d'orientation des deux brins


    voila mon exrcice
    soit une squence de bases présente sur un brin d'ADN _brin 1_
    recopiez cette squence et ecrivez la séquence de brin d'ADN complémentaire
    sachant que l'ARNm issu de la transcription de ce fragment d'ADN code le début d'une proteine
    determiner quelle est le brin matrice justifier votre réponce et ecriver la séquence de l'ARNm
    orienter la séquence toute les sequence des acide nucléique

    mon problème c'est l'orientation seulement
    aider moi s'il vous plait j'ai un examen la semain prochaine

    et merci avance


  2. Publicité
  3. 📣 Nouveau projet éditorial de Futura
    🔥🧠 Le Mag Futura est lancé, découvrez notre 1er magazine papier

    Une belle revue de plus de 200 pages et 4 dossiers scientifiques pour tout comprendre à la science qui fera le futur. Nous avons besoin de vous 🙏 pour nous aider à le lancer...

    👉 Je découvre le projet

    Quatre questions à explorer en 2022 :
    → Quels mystères nous cache encore la Lune 🌙 ?
    → Pourra-t-on bientôt tout guérir grâce aux gènes 👩‍⚕️?
    → Comment nourrir le monde sans le détruire 🌍 ?
    → L’intelligence artificielle peut-elle devenir vraiment intelligente 🤖 ?
  4. #2

    Re : probléme d'orientation des deux brins

    Je suis en attente de vos aide

  5. #3

    Re : probléme d'orientation des deux brins

    Je suis en attente de vos aide s'il vous plait

  6. #4

    Re : probléme d'orientation des deux brins


    comme tu sais que le fragment code le debut d'une protéine, tu devrais trouver un codon ATG. donc le sens tu le trouveras selon la presence de l'ATG.


  7. A voir en vidéo sur Futura
  8. #5

    Re : probléme d'orientation des deux brins

    merci pour votre réponse
    voila moi j'ai fai comme ca
    pour le brin complémentaire
    CTCAATGTGCGCTAAAATATATCG brin 2 (brin complémentaire)
    alors vous avez dit j'ai cherché le codant initiateur ATG et j'lai trouvé dans le brin 2 (brin complémentaire)
    et pour l'orientation moi j'ai orienté les deux brins comme ca
    5'CTCAATGTGCGCTAAAATATATCG3' brin 2 (brin complémentaire)

    et en fin l'ARNm
    il ya une chose je n'arrive pas a comprendre
    je sais que la transcription débute a parire du codant initiateur ATG mais dans cet exercice le codant initiateur il est au milieu alors ma question est ce que je comence la transcription a partire de ATG c'est a dire j'ecrit comme ça


    ou bien je transcrit toute la séquence de début jusqua la fins c a d


    et merci avance

  9. #6

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Yoyo Voir le message

    comme tu sais que le fragment code le debut d'une protéine, tu devrais trouver un codon ATG. donc le sens tu le trouveras selon la presence de l'ATG.

    merci pour votre réponse
    voila moi j'ai fai comme ca
    pour le brin complémentaire
    CTCAATGTGCGCTAAAATATATCG brin 2 (brin complémentaire)
    alors vous avez dit j'ai cherché le codant initiateur ATG et j'lai trouvé dans le brin 2 (brin complémentaire)
    et pour l'orientation moi j'ai orienté les deux brins comme ca
    5'CTCAATGTGCGCTAAAATATATCG3' brin 2 (brin complémentaire)

    et en fin l'ARNm
    il ya une chose je n'arrive pas a comprendre
    je sais que la transcription débute a parire du codant initiateur ATG mais dans cet exercice le codant initiateur il est au milieu alors ma question est ce que je comence la transcription a partire de ATG c'est a dire j'ecrit comme ça


    ou bien je transcrit toute la séquence de début jusqua la fins c a d


    et merci avance

  10. Publicité
  11. #7

    Re : probléme d'orientation des deux brins


    La transcription ne démarre pas à un codon ATG! c'est la traduction !!! ce n'est pas du tout la meme chose.
    Deplus un ARNm ne commence pas par un ATG, il y a toujours des régions non traduites au début et a la fin d'un ARNm.


  12. #8

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Yoyo Voir le message

    La transcription ne démarre pas à un codon ATG! c'est la traduction !!! ce n'est pas du tout la meme chose.
    Deplus un ARNm ne commence pas par un ATG, il y a toujours des régions non traduites au début et a la fin d'un ARNm.

    merci beaucoup
    maintenant j'ai bien compris

    oui oui c'est vrai c'est la traduction qui commence a partir d'un codant initiateur ATG
    alors la réponse normalement c'est comme ca
    5'CTCAATGTGCGCTAAAATATATCG3' brin 2 (brin complémentaire)


    maintenant je voudrai seulement connaitre les cas d'orientation
    par exemple s'ils m'ont donné une séquence comme ca
    _________________ATG ou bien GTA_________________

    pour l'orientation
    moi je vais répondre comme ca
    5' _________________ATG3'


    est ce que ca c'est vrai ??? et existent-ils d'autres cas?

    merci encore fois
    vous étés très gentille

  13. #9

    Re : probléme d'orientation des deux brins


    Il y a une petite erreur.

    5'CTCAATGTGCGCTAAAATATATCG3' brin 2 (brin complémentaire)

    La troisième base (par abus de langage nucléotide) du brin complémentaire est "G" et non "C".

    Sinon ça a l'air bon, la traduction débute au codon AUG correspondant au triplet ATG.

    Pour connaître l'orientation c'est simple, soit on te donne une séquence d'ADN orientée.
    Le brin complémentaire est orienté inverse car les deux brins d'ADN sont anti-parallèles, exemple :

    5' ATAC[...]TCC 3'

    le brin complémentaire sera orienté

    3' TATG[...]AGG 5'

    puis ensuite l'ARNm sera orienté de la même manière que le brin d'ADN transcrit puisqu'il en est la copie, seul le brin complémentaire ARN sera orienté inverse de l'autre brin ARN car ils sont aussi anti-parallèles (ici il s'agit du brin complémentaire d'ADN)

    donc on a avec notre exemple :

    3' UAUG[...]AGG 5'

    À noter qu'à chaque fois tu peux orienter le brin à l'inverse mais en commençant à lire de la droite vers la gauche dans ce cas-là, par exemple pour le brin d'ADN complémentaire, on peut l'orienter de 5' vers 3' de cette façon :

    5' GGA[...]GTAT 3'

    Soit on ne te donne pas l'orientation du brin initial d'ADN et là c'est à toi de la déterminer.
    Dernière modification par Meiosis ; 14/07/2012 à 22h21.

  14. #10

    Re : probléme d'orientation des deux brins

    Donc pour déterminer l'orientation du brin d'ADN s'il n'est pas donné il faut savoir que le brin transcrit est toujours orienté 5' vers 3'.
    Dernière modification par Meiosis ; 14/07/2012 à 22h38.

  15. #11

    Re : probléme d'orientation des deux brins

    À noter que l'ARN est le plus souvent présent sous forme de simple brin donc on en rencontre rarement sous forme double brin (exemple des virus à ARN double brin rotavirus).

  16. #12

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Meiosis Voir le message
    Donc pour déterminer l'orientation du brin d'ADN s'il n'est pas donné il faut savoir que le brin transcrit est toujours orienté 5' vers 3'.

    bonsoir merci beaucoup pour vos explications
    J'ai commencé à comprendre

    donc je confirme a partir de votre premier exemple que le brin matrice (non transcrit ou sens ) toujours comporte le codon initiateur ATG

    comme par exemple

    Le brin complémentaire est comme ca


    maintenant pour faire l'orientation je cherche le codon ATG dan l'un des deux brin

    j'lai trouvé dans ce brin GTAAACT________CCT mais sous forme de GTA alors ce brin est le brin sens
    et l'orientation cava etre comme ca
    5'CATTTGA________GGA3' brin 1
    3'GTAAACT________CCT5' brin 2

    merci encore fois

  17. Publicité
  18. #13

    Re : probléme d'orientation des deux brins

    Oui voilà, il faut repérer le triplet (et non le codon) ATG dans la séquence d'ADN (il est présent dans l'un des deux brins).
    Une fois trouvé on oriente de 5' vers 3' et donc naturellement l'autre brin qui ne comporte pas le triplet ATG sera orienté 3' vers 5'
    Puis après concernant l'ARNm il est toujours orienté 5' vers 3' donc c'est bon.

    Je crois que ça se passe comme ça, à confirmer quand même.

    J'ai trouvé un contre-exemple de ce qu'on est en train de dire donc je ne sais plus trop : http://step.ipgp.jussieu.fr/images/8...omineraux4.pdf

  19. #14

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Meiosis Voir le message
    Oui voilà, il faut repérer le triplet (et non le codon) ATG dans la séquence d'ADN (il est présent dans l'un des deux brins).
    Une fois trouvé on oriente de 5' vers 3' et donc naturellement l'autre brin qui ne comporte pas le triplet ATG sera orienté 3' vers 5'
    Puis après concernant l'ARNm il est toujours orienté 5' vers 3' donc c'est bon.

    Je crois que ça se passe comme ça, à confirmer quand même.

    J'ai trouvé un contre-exemple de ce qu'on est en train de dire donc je ne sais plus trop : http://step.ipgp.jussieu.fr/images/8...omineraux4.pdf
    maintenant j'ai commencé a comprendre un peu
    merci beaucoup pour vos aides

  20. #15

    Re : probléme d'orientation des deux brins

    Citation Envoyé par bilal31 Voir le message
    maintenant j'ai commencé a comprendre un peu
    merci beaucoup pour vos aides
    Attention quand même dans le lien que j'ai donné l'orientation n'est pas la même et je ne sais pas pourquoi.
    Si quelqu'un pouvait éclaircir la situation ce serait bien.

  21. #16

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Meiosis Voir le message
    Attention quand même dans le lien que j'ai donné l'orientation n'est pas la même et je ne sais pas pourquoi.
    Si quelqu'un pouvait éclaircir la situation ce serait bien.
    nous avons traités un seul cas d'orientation c'est a dire le triplet ATG mais il nous reste celui de GTA parce que je sais que il y a une différence entre les deux alors je vais essayer de chercher pour mieux comprendre

    je vous remercie pour votre patience avec moi

  22. #17

    Re : probléme d'orientation des deux brins


    Le codon initiateur qu'il faut chercher ce n'est pas plutôt AUG soit TAC ? Et non ATG ?

  23. #18

    Re : probléme d'orientation des deux brins

    Ah non au temps pour moi, c'est le brin non transcrit qui comporte ATG et le brin transcrit comporte TAC.
    Je corrige une erreur que vous avez faite, le brin matrice n'est pas le brin non transcrit ! C'est le brin transcrit.

  24. Publicité
  25. #19

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Meiosis Voir le message
    Ah non au temps pour moi, c'est le brin non transcrit qui comporte ATG et le brin transcrit comporte TAC.
    Je corrige une erreur que vous avez faite, le brin matrice n'est pas le brin non transcrit ! C'est le brin transcrit.
    nous sommes mis d’accord ce qui concerne le brin non transcrit comporte ATG et le brin transcrit comporte CAT ici c'est bon
    et pour le brin matrice c'est vrai vous avez raison Le brin transcrit, ou brin matrice, est le brin d'ADN qui est utilisé pour effectuer la transcription c'est a dire le brin qui comporte le brin TAC
    et si vous trouverez une chose concernant l’orientation pour les fragments qui contiennent GTA fait moi signe


  26. #20

    Re : probléme d'orientation des deux brins


    Tout ce que je peux dire c'est que le brin simple d'ARN est toujours de même séquence (à l'exception des T remplacés par des U) et de même orientation que le brin non-transcrit (ou codant) d'ADN.
    Donc le brin d'ARNm est orienté inverse du brin transcrit car il est anti-parallèle.

    Donc si on a le brin transcrit d'ADN ça donne déjà une indication sur l'orientation et la séquence du brin d'ARNm.
    Dernière modification par Meiosis ; 16/07/2012 à 13h28.

  27. #21

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Meiosis Voir le message

    Tout ce que je peux dire c'est que le brin simple d'ARN est toujours de même séquence (à l'exception des T remplacés par des U) et de même orientation que le brin non-transcrit (ou codant) d'ADN.
    Donc le brin d'ARNm est orienté inverse du brin transcrit car il est anti-parallèle.

    Donc si on a le brin transcrit d'ADN ça donne déjà une indication sur l'orientation et la séquence du brin d'ARNm.
    oui c'est comme ca
    et merci pour toute vos indications

  28. #22

    Re : probléme d'orientation des deux brins

    Je rajoute que sens de lecture d'un brin et orientation sont différents.
    Un brin peut par exemple être orienté 3' vers 5' mais être lu soit 5' vers 3' soit 3' vers 5' ce qui n'est pas la même chose.

    J'avoue ne pas comprendre la correction de cet exercice : http://step.ipgp.jussieu.fr/images/8...omineraux4.pdf (en page 2)

    le brin d'ARN m est toujours lu par les ribosomes dans le sens 5' vers 3', seulement si on le lit dans ce sens on tombe sur un codon GUA.
    Et si on lit dans le sens 3' vers 5' on tombe sur le codon d'initiation AUG (ce qui est logique).

    Donc je ne sais pas trop pourquoi on tombe sur le codon GUA au lieu de AUG.

    Si tu sais me l'expliquer fais-moi signe, ça éclaircira beaucoup de choses.

  29. #23

    Re : probléme d'orientation des deux brins

    alors comme vous avez dit par exemple pour un brin orienté 3' vers 5' peut etre lu dans le sens 5' vers 3' exemple
    3'TAA------CTG5' brin 1
    5'GTC------AAT3' brin1 C'est la méme chose

    mais pour différencie le brin transcrit de celui non transcrit il faut reperer le triplet ATG OU GTA ET quant tu trouve l'un de ces deux triplet dan un brin alors c'est a dire ce brin est celui de brin non transcrit et il ne faut pas baser sur l'orientation par exemple dans cet brin GTATTA------ACT alors comment on fait l'orientation ici
    alors il faut remarquer que letripet ATG et sous forme GTA si on lit de l'agauche vers la droite alors pour faire l'orientation normalement c'est comme ca
    3'GTATTA-----ACT5' brin non transcrit

    5'CATAAT----TGA3' brin transcrit

    et pour l'ARNm a la meme structure que le brin non transcrit mais U remplace T

    REGARDEZ CE EXERCICE 5 celui de tableau http://www.chusa.jussieu.fr/disc/PCE...BM_2011-12.pdf
    et pour cet exercice on a fait la correction et je suis sur
    alors moi a partir de cet exercice j'ai tiré une conclusion que il y a plusieurs cas pour l'orientation et voila les cas
    5'ATG________3' et pour les cas c'était ma conclusion je ne suis pas sur

  30. #24

    Re : probléme d'orientation des deux brins

    Décidément je ne comprends plus rien.

    J'espère que vous avez compris, ce n'est pas mon cas.

  31. Publicité
  32. #25

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Meiosis Voir le message
    Décidément je ne comprends plus rien.

    J'espère que vous avez compris, ce n'est pas mon cas.
    oui normalement j'ai compris pour deux cas

    mais est ce que vous avez vu l'exercice

  33. #26

    Re : probléme d'orientation des deux brins

    Citation Envoyé par bilal31 Voir le message
    oui normalement j'ai compris pour deux cas

    mais est ce que vous avez vu l'exercice
    Non je n'ai pas vu ce genre d'exercices, je m'entraine chez moi en fait pour m'avancer mais je ne comprends pas grand chose..

  34. #27

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Meiosis Voir le message
    Non je n'ai pas vu ce genre d'exercices, je m'entraine chez moi en fait pour m'avancer mais je ne comprends pas grand chose..

    ah ok en tout les cas moi je suis sur pour la correction de cet exercice parce qu’on a fait a l'université

  35. #28

    Re : probléme d'orientation des deux brins

    Citation Envoyé par bilal31 Voir le message
    ah ok en tout les cas moi je suis sur pour la correction de cet exercice parce qu’on a fait a l'université
    Bonne chance pour la suite alors.
    De mon côté je vais essayer de comprendre, c'est pas gagné !

  36. #29

    Re : probléme d'orientation des deux brins

    Citation Envoyé par Meiosis Voir le message
    Bonne chance pour la suite alors.
    De mon côté je vais essayer de comprendre, c'est pas gagné !

    a vous méme
    espérons la réussite

Discussions similaires

  1. tension des brins d'une courroie SYNCHRONE
    Par fred210 dans le forum Technologies
    Réponses: 12
    Dernier message: 21/06/2011, 14h40
  2. [Biochimie] Structure des protéines (hélices, brins...)
    Par minette 888 dans le forum Biologie
    Réponses: 0
    Dernier message: 10/01/2010, 20h33
  3. tension des brins
    Par lettya dans le forum Technologies
    Réponses: 14
    Dernier message: 21/04/2009, 18h35
  4. ADN Séparation des brins
    Par Saian dans le forum Biologie
    Réponses: 2
    Dernier message: 14/04/2004, 09h46
Découvrez nos comparatifs produits sur le sport et la santé.