Répondre à la discussion
Affichage des résultats 1 à 11 sur 11

(1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)



  1. #1
    amyam0

    Exclamation (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Bonjours, je suis en 1ère S et m'a prof de SVT nous a demandé de réaliser un schéma bilan du gène à la protéine pour la rentrée en donnant l'énoncée tel que :
    Dans une cellule, placer et localiser la transcription et la traduction avec tous les acteurs nécessaires.
    L'épissage sera noté en bonus.
    La protéine formée en fin de traduction sera l'ocytocine (voir cours).
    Les légendes seront organisées et placée en dehors du schéma.
    Le schéma sera de grande taille et en couleurs.
    Mots clés: noyau, cytoplasme, enveloppe nucléaire, pores nucléaires, cellule, transcription, traduction, (maturation ou épissage), ARN messager, (ARN prémessager), ADN, nucléotide, acide aminé, protéine ou polypeptide, ribosome, ARNpolymérase, énergie, intitiation, élongation, terminaison, codon stop, codon d'initiation, codon, brin transcrit, brin non transcrit, (exons, introns), ocytocine
    avec Ocytocine ; ACGATGTAGGTCTTGACGGGGGACCCG
    TGCTACATCCAGAACTGCCCCCTGGGC



    Je connais à peu près toutes étapes sauf que je bloque au niveau de l'épissage, il y a beaucoup de questions qui me viennent et qui me font bloquer sur le reste...
    Surtout c'est quoi
    la différence entre ARN et ARNm ( ont ils la meme séquences de nucléotides, qu'est ce qui change, quels snt les exons les introns, leurs séquences de nucléotides par rapport à l'ocytocine....) etc etc

    Désolée du roman..
    Merci d'avance, bisoux

    -----


  2. Publicité
  3. #2
    Zoobio

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Bonjour,

    Alors, comme tu l'as surement compris, la transcription consiste en la production d'un ARN pré-messager complémentaire de l'ADN "d'origine". L'ARN pré-messager est donc une copie (faite grâce à une enzyme, l'ARN polymérase). Mais l'ARN pré-messager est une molécule trop imposante pour sortir du noyau, elle va donc subir la maturation. C'est lors de cette maturation que va se produire l'épissage : les portions non-codantes, ou introns, sont supprimées (les exons sont rattachés entre eux par la suite). On aboutit ainsi à la formation de l'ARN messager (ARNm). Cet ARNm, dans le cytoplasme, va subir la traduction au niveau des ribosomes.
    Il existe plusieurs types d'ARN, dont certains ne sont même pas traduits en protéines.
    Dans ton cas, tu ne peux pas deviner la séquence des introns, rien ne te permet de les connaître.

  4. #3
    amyam0

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Ah d'accord, donc l'ARN pré-messager et identique à l'ARN messager ( même séquences de nucléotides), si j'ai bien compris ?
    Mais pourquoi nous demande t elle de le montrer sur le schéma alors que ils snt identiques ? Et comment je pourais le réaliser ?
    (désolé du retard...)

  5. #4
    Zoobio

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Pas tout à fait, l'ARN messager est dépourvu des introns (l'ARN pré-messager les possède encore).

  6. #5
    noir_ecaille

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Si vous avez la séquence d'acides aminés de ocytocine, en partant du triplet d'initiation (que vous devez connaître ) vous devriez retrouver quelles sont les parties de l'ARN brut traduites (les exons formant l'ARNm) de celles qui ne le sont pas (les introns épissés)
    "Deviens ce que tu es", Friedrich W. Nietzsche

  7. A voir en vidéo sur Futura
  8. #6
    minushabens

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Au fait qu'est-ce qu'ils deviennent les introns? Ils sont dégradés dans le noyau ou dans le cytoplasme?

  9. Publicité
  10. #7
    noir_ecaille

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Plus probablement dégradés. Pour une question de fonctionnalité, je pense que ça se passe dans le cytoplasme au même titre que les ARNm et autres qui ont rempli leur office -- ce serait plus problématique d'avoir une dégradation d'ARN dans le noyau alors même qu'ils y sont synthétisés.

    Quant au mécanisme ?... Tag via ARNi ? Autre ?
    "Deviens ce que tu es", Friedrich W. Nietzsche

  11. #8
    amyam0

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Waw j'ai l'impression de ne rien connaitre en vous lisant..
    Etant donné que notre prof nous a jamais parlé de triplet d'initiation o va dire qu'elle ne l'attend pas.
    0ui j'ai la séquence de nucléotides d'acides aminés de l'ocytocine ; Cys Ser Ile Glu Asn Cys Pro Leu Gly

  12. #9
    noir_ecaille

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Vous n'avez pas un tableau du code génétique ?

    Ne vous occupez pas des trucs trop compliqués genre ARNi etc ^^; Vous verrez ça en temps voulu
    Dernière modification par noir_ecaille ; 29/10/2014 à 19h26.
    "Deviens ce que tu es", Friedrich W. Nietzsche

  13. #10
    amyam0

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    Si si j'en ai un .


    0ui c'est se que je pense faire ..

  14. #11
    Alhec

    Re : (1èreS) Schéma bilan du gène a la protéine ; Bloquer au niveau de la maturation.. (épissage)

    L'ocytocine est produite par hydrolyse progressive d'une protéine précurseur inactive... C'est vraiment un mauvais exemple, je ne comprends pas pourquoi on s'obstine à donner aux élèves ce genre de "protéines"... D'aileurs la séquence donnée ici ne correspond pas du tout à celle qu'on trouve dans les bases de données sur l'ocytocine, enfin bref (http://www.ebi.ac.uk/ena/data/view/M25650) amyam0, ne tient pas compte de cette dernière phrase

    Sinon, le triplet d'initation = le codon d'initation, donc votre prof' l'attend certainement k: Il n'est pas difficile à trouver, il n'y en a qu'un dans votre séquence et il correspond à un acide aminé bien spécifique.

Sur le même thème :

Discussions similaires

  1. [Biologie Moléculaire] Gene-ARN-Proteine
    Par Alexa-Gyndom dans le forum Biologie
    Réponses: 8
    Dernier message: 29/12/2012, 18h13
  2. [Biologie Moléculaire] un gène= une proteine ??????
    Par miliasma6600 dans le forum Biologie
    Réponses: 10
    Dernier message: 21/05/2011, 07h20
  3. [Biologie Moléculaire] D'une protéine à un gène à une protéine
    Par Willly dans le forum Biologie
    Réponses: 6
    Dernier message: 29/07/2009, 19h25
  4. [Biotechnologie] Bloquer l'expression d'un gène chez la levure
    Par XIII dans le forum Biologie
    Réponses: 6
    Dernier message: 24/04/2008, 14h52
  5. relation gene proteine
    Par Corona dans le forum Biologie
    Réponses: 1
    Dernier message: 10/10/2004, 16h49