Répondre à la discussion
Affichage des résultats 1 à 16 sur 16

[1èreS] Lire la séquence d'une protéine



  1. #1
    étoilenoire

    [1èreS] Lire la séquence d'une protéine

    Bonsoir à tous !
    J'ai un nouvel exercice à faire et je ne m'en sors pas...
    Même avec ma leçon j'ai du mal à comprendre ce que l'on me demande et à répondre aux questions...


    --------------------------------------------------------------------------

    Ona une protéine humaine composée de 302 acides aminés.
    Voici un fragment d'ADN contenant le début de la phrace codante du gène correspondant :

    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAACG
    CCATACTAGGTCGTTTGGATTCGTACATTG TTGAGGCGTCGATCCGTATTGC


    1. Identifiez le début de la phase codante du gène.
    Quel est le brin d'ADN porteur de l'information génétique responsable de la formation de la protéine?

    2. Ecrivez la séquence nucléotidique du fragment d'ARNm codant pour le début de la protéine.

    3. Déduisez le début de la séquence de la protéine.

    4. On a isolé une protéine mutante dans laquelle la première sérine est remplacée par une arginine.
    Quelles mutations nucléotidiques rendent compte de ce changement d'acide aminé?

    5. Dans une pathologie, on trouve une forme écourtée de la protéine : seuls les trois premiers acides aminés sont présents. Quelle mutation nucléotidique peut-on prédire ?

    --------------------------------------------------------------------------

    Voici mes premières réponses :

    1. Le début de la phase codante du gène... Il s'agit du 1er codon ? c'est à dire : GGT ?
    et comment puis-je savoir quel brin porte l'information génétique ?

    2. Pour cela, comment savoir quel brin d'ADN est la réplique de l'ARNm ? car après pour écrire la séquence nucléotidiqe de l'ARNm, je réécris la séquence du brin d'ADN qui sert de moule en remplaçant la thymine par l'uracile... Je me trompe ?

    3. Pour cette question, on nous donne le code génétique, mais je ne peux y répondre tant que je n'ai pas réécris la séquence de nucléotide de l'ARNm...

    4. Je ne pense pas avoir bien compris la question... Si de la sérine est remplacée par de l'arginine, c'est un mutation neutre ou une mutation faux-sens non ? car il y a eu une substitution...

    5. Il y a eu délétion de nucléotides
    On a eu une mutation non-sens...

    --------------------------------------------------------------------------

    Voilà, comme vous pouvez le constater mes réponses sont très vagues, incomplètes et je ne suis absolument pas sûre de ce que je raconte...

    Merci d'avance pour vos réponses

    -----


  2. Publicité
  3. #2
    étoilenoire

    Re : Exercice 1ère S : lire la séquence d'un protéine

    Excusez-moi, j'ai remarqué que j'avais fait pas mal d'erreur en tapant la séquence nucléotidique (et le délai d'édition a expiré )

    Donc je vous remets les 2 chaines justes :

    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAACG
    CCATACTAGGACCTTTGGATTGCTACATTG AAGAGCCGTCGATCCGTATTGC


    Bonne soirée à tous

  4. #3
    piwi

    Re : Exercice 1ère S : lire la séquence d'un protéine

    Pour t'aider dans ta résolution.
    (1) Pour pouvoir commencer à produire une protéine il faut un codon méthionine.
    (2) Si la protéine fait 300 acides aminés c'est qu'il ne se trouve pas de codon stop dans cet intervalle.
    (3) Le code génétique peut être trouvé ici: http://www.snv.jussieu.fr/bmedia/cod.../CodeGenet.htm
    (4) Bon courage!

    Cordialement,
    piwi
    Je sers la science et c'est ma joie.... Il parait.

  5. #4
    étoilenoire

    Re : Exercice 1ère S : lire la séquence d'un protéine

    Merci de m'avoir répondu Piwi

    1. Un codon méthionine est le codon initiateur AUG :
    Il s'agit donc d'un codon ATG puisque la thymine est remplacée par de l'uracile soit :

    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAACG
    CCATACTAGGTCGTTTGGATTCGTACATTG TTGAGGCGTCGATCCGTATTGC

    Le brin porteur de l'information génétique est :
    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAACG
    Je me trompe ?

    2. la séquence nucléotidique du fragment d'ARNm est donc :
    GGUAUGAUCCAGCAAACCUAACGAUGUAAC AACUCCGCAGCUAGGCAUAACG
    (J'ai remplacé la thymine par de l'uracile)

    3. GlyMetIleGlnGlnThr
    puis comme on a UAA c'est la fin de la molécule d'ARNm puisqu'il s'agit d'un codon STOP

    Voilà, n'hésitez pas à me dire si mon raisonnement est faux

    Merci encore pour ton aide !

  6. #5
    piwi

    Re : Exercice 1ère S : lire la séquence d'un protéine

    bonjour,

    Si je traduits à partir de la méthionine la séquence d'ADN que vous avez choisi, j'obtiens ça:
    ATG ATC CAG CAA ACC TAA CGA TGT AAC AAC TCC GCA GCT AGG CAT AAC G
    MetIQQTStop R C N N S A A R H N

    Sachant que votre chaine polypeptidique fait 308 acides aminés, qu'en pensez vous?

    Cordialement,
    piwi
    Je sers la science et c'est ma joie.... Il parait.

  7. A voir en vidéo sur Futura
  8. #6
    étoilenoire

    Re : Exercice 1ère S : lire la séquence d'un protéine

    heu que la molécule d'ARNm est beaucoup plus courte ?

    Je ne sais pas... vu que dès le départ, on nous donne qu'en fragment d'ADN... la prase codante du gène est beaucoup moins importante... Je veux dire... par rapport à la protéine entière...

  9. Publicité
  10. #7
    piwi

    Re : Exercice 1ère S : lire la séquence d'un protéine

    Allons, réflechissons! Un acide aminé est codé par 3 nucléotides successifs, un codon. Donc pour avoir 300 acides aminés il faut 300 codons. De plus pour avoir ces 300 acides aminés il ne faut pas qu'il y ait de codon stop dans l'enchainement des codons, faute de quoi la traduction s'arrêterait.

    Est ce le cas dans votre approche?
    Je sers la science et c'est ma joie.... Il parait.

  11. #8
    étoilenoire

    Re : Exercice 1ère S : lire la séquence d'un protéine

    non, ce n'est pas le cas...
    Je n'ai que 5 codons et un codon stop...

    Mais si la protéine fait 300 acides aminés, il y a aussi 300 acides aminés dans la molécule d'ARNm ?


    (excusez-moi je suis un peu longue à comprendre...)

  12. #9
    MaliciaR

    Re : Exercice 1ère S : lire la séquence d'un protéine

    Citation Envoyé par étoilenoire Voir le message
    Mais si la protéine fait 300 acides aminés, il y a aussi 300 acides aminés dans la molécule d'ARNm ?
    Entendons-nous bien : qui est constitué d'acides aminés, l'ARN ou les protéines?

    Sinon, je vous repose la question de Piwi :
    Allons, réflechissons! Un acide aminé est codé par 3 nucléotides successifs, un codon. Donc pour avoir 300 acides aminés il faut 300 codons. De plus pour avoir ces 300 acides aminés il ne faut pas qu'il y ait de codon stop dans l'enchainement des codons, faute de quoi la traduction s'arrêterait.

    Est ce le cas dans votre approche?
    Si l'hypothèse que vous avez considérée plus haut ne donne pas le bon résultat, on change d'hypothèse

    Cordialement,
    An expert is one who knows more and more about less and less.

  13. #10
    étoilenoire

    Re : Exercice 1ère S : lire la séquence d'un protéine

    Merci à vous de m'apporter votre aide

    Citation Envoyé par MaliciaR Voir le message
    Entendons-nous bien : qui est constitué d'acides aminés, l'ARN ou les protéines?
    les protéines ! ^^
    L'ARNm est utilisé pour fabriquer les protéines

    mais après je ne vois vraiment pas comment faire maintenant...

  14. #11
    cocosse

    Re : Exercice 1ère S : lire la séquence d'un protéine

    Salut c'est pour savoir si tu avais eu le corriger de cet exercice parce que je comprend pas trop merci de ta reponse.

  15. #12
    étoilenoire

    Re : Exercice 1ère S : lire la séquence d'une protéine

    Ja suis désolée mais la correction de cet exercice est loin (très loin) dans mes cours de 1ères et je n'ai pas le temps pour le moment de la rechercher. Mais si tu n'y arrive vraiment pas et que tu as encore le temps alors j'essaierai de te la chercher.

  16. Publicité
  17. #13
    Nassal

    Re : Exercice 1ère S : lire la séquence d'une protéine

    Désolé de déterrer d'anciens post, cependant, j'ai exactement le même exercice, et après toutes ces explications je continue de bloquer ... :/

    Est ce que quelqu'un possède le corrigé pour que je comprenne, ou bien y'a t'il quelqu'un d'expérimenté qui pourrait m'expliquer, je pensais le raisonnement d'étoile noire juste, et depuis la réponse qui l'avère faux je ne vois pas comment faire ...

    Merci d'avance

  18. #14
    sohayla

    Re : [1èreS] Lire la séquence d'une protéine

    merci beaucoup

  19. #15
    Zellus

    Re : [1èreS] Lire la séquence d'une protéine

    Bonsoir,

    Il faut d'abord chercher tous les codons ATG présents sur les deux brins d'ADN et voir à partir duquel on peut obtenir une protéine de 302 acides aminés.
    Petit rappel : Le brin du haut se lit de gauche à droite et celui du bas de le droite vers la gauche.

  20. #16
    Lio22

    Re : [1èreS] Lire la séquence d'une protéine

    Bonjour à tous,

    Comme il n'y a pas de réponses définitves pour ce post, voici les réponses aux différentes questions posées:

    1. Soit une protéine humaine composée de 302 acides aminés. On a isolé un fragment d’ADN contenant le début de la phase codante du gène correspondant :

    Brin 1 : GGT ATG ATC CAG CAA ACC AAA CGA TGT AAC AAC TCC GCA GCT AGG CAT AAC G
    Brin 2 : CCA TAC TAG GTC GTT TGG TTT GCT ACA TTG TTG AGC CGT CGA TCC GTA TTG C

    On sait que la traduction d’un ARNm en polypeptide débute à partir d’un codon initiateur AUG. Le début de la séquence codante du gène correspond donc à la présence d’un triplet ATG dans le brin non transcrit du gène. On recherche donc dans l’un ou l’autre des 2 brins d’ADN proposés la séquence ATG. Cela permet d’identifier non seulement le début de la phase codante, mais aussi les brins transcrit et non transcrit. Par cette méthode, on repère le début de la phase codante au deuxième triplet du brin 1 ; on en déduit que le brin 1 est le brin non transcrit ou codant et que le brin 2 est brin transcrit ou non codant.

    2. Ecrivez la séquence nucléotidique du fragment d’ARNm codant pour le début de la protéine.

    AUG AUC CAG CAA ACC AAA CGA UGU AAC AAC UCC GCA GCU AGG CAU AAC

    3. Déduisez, grâce au code génétique le début de la séquence de la protéine

    Met-ile-gln-gln-thr-lys-arg-cys-asn-asn-ser-ala-ala-arg-his-asn

    4. On a isolé une protéine « mutante » dans laquelle la première sérine est remplacée par une arginine. Quelles mutations nucléotidiques rendent compte de ce changement d’acide aminé ?

    Ce changement correspond à une mutation par substitution de type faux-sens.

    Bonne journée,

    Lio

Sur le même thème :

Discussions similaires

  1. [Pré-BAC] [1ereS] Trouver une sequence d'acide aminee et le brin codant
    Par pierredelyon dans le forum Exercices en biologie
    Réponses: 2
    Dernier message: 19/02/2010, 18h13
  2. [Biologie Moléculaire] D'une protéine à un gène à une protéine
    Par Willly dans le forum Biologie
    Réponses: 6
    Dernier message: 29/07/2009, 19h25
  3. Réponses: 2
    Dernier message: 12/01/2009, 20h40
  4. [Génétique] Influence d'une mutation sur la synthese d'une protéine.
    Par Arks dans le forum Biologie
    Réponses: 2
    Dernier message: 01/11/2008, 17h53
  5. [Biologie Moléculaire] Brin transcrit => Séquence de protéine
    Par Monstiney dans le forum Biologie
    Réponses: 1
    Dernier message: 22/10/2008, 18h48