Répondre à la discussion
Affichage des résultats 1 à 24 sur 24

DM 1ère S biologie



  1. #1
    gi-gi

    DM 1ère S biologie


    ------

    Salut tout le monde j'ai un DM à rendre pour la semaine prochaine, et dedans
    y'a presque que des exos sur ce qu'on a pas encore étudié donc je comprend
    pas très bien ce qu'on me demande:

    Exercice 1:
    Soit une protéine humaine composée de 302 acides aminés. On a isolé un
    fragment d'ADN contenant le début de la pahse codante du gène correspondant:

    (là on a deux séquences de nucléotides deux brins en fait)

    Questions:
    1.Identifiez le début de la phase codante du gène. Quel est le brin d'ADN
    porteur de l'information génétique responsable de la formation de la
    protéine.
    2. Ecrivez la séquence nucléotidique du fragment d'ARNm codant pour le début
    de la protéine.

    y'a que pour la 1 en fait que j'ai besoin d'aide, je sais que un seul des deux brins d'ADN porte l'information génétique, c'est le brin transcrit mais celui du haut ou celui du bas comment savoir vu que je n'ai pas de séquence d'ARNm...
    Qu'est-ce qu'on me demande par identifiez la phase codante du géne?

    merci
    @+
    gi-gi

    -----

  2. #2
    kron

    Re : DM 1ère S biologie

    il faudrait que tu nous montres tes brins... Sinon un gène commence toujours par un codon de départ (je ne sais plus quel triplets) mais ton livre le dit surement. Il y a en fait des phases d'ADN qui ne codent rien du tout. C'est que du surplus sans importance. De toute façon vu que ton ARNm va être decrypté (ARN polymérase et autres enzymes) peut importe quel brin de toute façon au final tu arriveras au meme resultat...
    Life is music !

  3. #3
    gi-gi

    Re : DM 1ère S biologie

    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAAC
    CCATACAAGGACCTTTGGATTGCTACATTG AAGAGCCGTCGATCCGTATTG

    j'ai vu sur internet que TAC était le codon de départ de l'ADN donc ici le gène ne code rien du tout et je peux chosir n'importe quel brin?

    merci
    @+
    gi-gi

  4. #4
    invite765732342432
    Invité

    Re : DM 1ère S biologie

    Citation Envoyé par gi-gi
    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAAC
    CCATACAAGGACCTTTGGATTGCTACATTGAAGAGC CGTCGATCCGTATTG
    C'est donc le second brin... (vérifie tout de même qu'il y a un codon stop)

  5. A voir en vidéo sur Futura
  6. #5
    vero0oo

    Re : DM 1ère S biologie

    Bonjour,

    En général, le codon d'initiation est AUG, codant pour la méthionine. C'est lui qui marque le début d'un ARNm, donc il faut rechercher le triplet complémentaire (TAC, en effet), quelquepart sur un des deux brins : début de la phase codante de la protéine.
    Phase codante, car on peut lire une séquence nucléique selon 3 phases, puisqu'il s'agit de triplets (en décalant chaque fois d'une base le début de la lecture). Mais une seule de ces phases, commençant au codon initiateur, code pour la protéine!

    Bon courage!

  7. #6
    gi-gi

    Re : DM 1ère S biologie

    en fait le brin comportant le codon initiateur TAC sera le brin transcrit, celui qui sera associé à l'ARNm?
    et pour écrire la séquence d'ARNm je commence à partir de TAC?

    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAAC
    CCATACAAGGACCTTTGGATTGCTACATTG AAGAGC CGTCGATCCGTATTG
    AUGUUCCU................

    merci pour vos réponses

    @+
    gi-gi

  8. #7
    vero0oo

    Re : DM 1ère S biologie

    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAAC
    CCATACAAGGACCTTTGGATTGCTACATTG AAGAGC CGTCGATCCGTATTG
    En fait, j'ai vu 2 TAC (le 2eme sur le premier brin en le lisant dans l'autre sens)
    Mais sinon, je suis d'accord avec ta séquence d'ARN

  9. #8
    gi-gi

    Re : DM 1ère S biologie

    comment on fait quand on tombe sur un codon-stop en plein milieu de la transcription

    AUG->met
    AUC->iso
    CUG->leuc
    GAA->acide glutamique
    ACC->thréon
    UAA->codon stop

    parce que j'ai commencé ma transcription à partir de TAC...

    merci
    @+
    gi-gi

  10. #9
    vero0oo

    Re : DM 1ère S biologie

    Si tu tombes sur un codon stop à ce niveau, ton peptide ne fait pas 302 mais 5 acides aminés!
    Essaie sur l'autre brin...

  11. #10
    gi-gi

    Re : DM 1ère S biologie

    daccord merci beaucoup pour votre aide
    merci
    @+
    gi-gi

  12. #11
    gi-gi

    Re : DM 1ère S biologie

    désolé d'insister mais dans les deux brins on trouve un codon-stop en début de séquence.
    mais est-ce que l'erreur peut venir du fait que je lis ma séquence de 3 en 3 nucléotides à partir des trois premiers:
    GGT|ATG|ATC|CAG|...

    ma séquence d'ARNm doit-elle absolument débutée par AUG?

    merci
    @+
    gi-gi

  13. #12
    vero0oo

    Re : DM 1ère S biologie

    oui, l'ARNm doit commencer par AUG (et pas par CCA, complémentaire de GGT...).
    Tu dois donc commencer à un triplet TAC de l'ADN. Celui sur le deuxième brin (lecture de gauche à droite) ne convient pas : codon stop au bout de 5 AA. Mais il y en a un 2e sur le brin du haut, qu'il faut lire de droite à gauche. Normalement, si tu traduis les triplets dans ce sens, à partir de ce TAC (3 nucléotides avant la fin, brin du haut), tu ne trouves pas de Stop.
    J'espère que cette fois c'est clair...

  14. #13
    nayeki

    Re : DM 1ère S biologie

    Le premier codon est toujours ATG c'est celui-la qu'il faut trouver


    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAAC
    CCATACAAGGACCTTTGGATTGCTACATTG AAGAGCCGTCGATCCGTATTG

    ici

    ATG ATC CAG CAAA CCT AAC GAT GTA ACA ACT CCG CAG CTA GGC ATA ACC CAT ACA AGG ACC TTT GGA TTG CTA CAT TGA AGA GCC GTC GAT CCG TAT TG
    Dernière modification par nayeki ; 30/01/2005 à 19h05.

  15. #14
    gi-gi

    Unhappy Re : DM 1ère S biologie

    je me suis rendu compte que j'ai fais une grosse erreur j'ai oublié de mettre le dernier nucléotide:
    brin1:
    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAACG

    brin 2:
    CCATACAAGGACCTTTGGATTGCTACATTG AAGAGC CGTCGATCCGTATTGC

    désolé....mais ça répond à ma question qu'il faut lire l'ADN de trois en trois en partant du premier de gauche à droite ou de droite à gauche

    merci pour tout
    @+
    gi-gi

  16. #15
    sand13

    Re : DM 1ère S biologie

    Eh Nayeki, le complémentaire d'ATG c'est pas AUG mais UAC, qui n'est pas le codon d'initiation. Je me permets cette petite remarque parce que j'ai l'impression qu'il n'y a pas que les voies métaboliques qu'il faut que tu révises....

    gi-gi tu lis de gauche à droite ou de droite à gauche, peu importe, de toute façon les extrémités 5' 3' ne sont pas précisées, donc tu le fais en partant d'un TAC qui te conduit à autre chose qu'un codon stop.

  17. #16
    sand13

    Re : DM 1ère S biologie

    D'un CAT, bien sûr, si tu lis de droite à gauche (cf post de verooo), et si tu lis de droite à gauche tous les autres aussi ; premier nucléotide du codon celui qui est le plus à droite.

  18. #17
    Yoyo

    Re : DM 1ère S biologie

    oui, l'ARNm doit commencer par AUG (et pas par CCA, complémentaire de GGT...).
    Non c'est faut l'ARNm ne débute JAMAIS par un AUG initiateur (si l'AUG etait le premier codon de l'ARNm le ribosome ne pourrait pas initier la traduction!). L'AUG est le premier codon de la pahse codante (partie qui va donner la protéine), mais l'ARNm lui commence généralement bien avant, par des nucléotides qui ne sont pas traduits (on parle de région 5' UTR, ou 5' non traduite).

    Sinon le brin transcript est bien celui du bas, qui va donner un ARNm de séquence identique (sauf T->U) au brin non transcrit. c'est évidemment cette séquence qu'il faut lire pour obtenir la protéine.

    Yoyo

  19. #18
    piwi

    Re : DM 1ère S biologie

    sequence de shine dalgarno chez les procaryotes
    sequence de Kozack (je crois que c'est ca hein?) chez les eucaryotes.
    Elles permettent dans les deux cas la fixation de la petite sous unité ribosomique au niveau du mRNA. C'est la première étape de l'initation de la transcription.
    Ca c'est pour etre complet.
    Maintenant c'est vrai que classiquement on dit que la transcription commence par un AUG et que le premier acide aminé apporté est la methionine (formyl-methionine chez les procaryote grage à un ARNt spécial)

    Dommage que je n'ai pas le temps vous aurais bien fais un petit cours là dessus

  20. #19
    gi-gi

    Re : DM 1ère S biologie

    merci pour toutes vos réponses

    mais le problème c'est que en prenant le deuxième ou le premier brin comme transcrit (c'est à dire que l'ARNm est une copie du non transcrit sauf les T) eh bien l'on tombe sur un codon stop or dans l'exercice on doit trouver de la sérine.
    Je voulais savoir aussi pourquoi dans le gène de l'exercice les A, C, T ne sont pas tout le temps complémentaires avec un autre A C T des fois on a A-A ou T-T ou C-C ...

    @+
    gi-gi

  21. #20
    Yoyo

    Re : DM 1ère S biologie

    Citation Envoyé par piwi
    sequence de shine dalgarno chez les procaryotes
    sequence de Kozack (je crois que c'est ca hein?) chez les eucaryotes.
    Elles permettent dans les deux cas la fixation de la petite sous unité ribosomique au niveau du mRNA. C'est la première étape de l'initation de la transcription.
    Ca c'est pour etre complet.
    Maintenant c'est vrai que classiquement on dit que la transcription commence par un AUG et que le premier acide aminé apporté est la methionine (formyl-methionine chez les procaryote grage à un ARNt spécial)

    Dommage que je n'ai pas le temps vous aurais bien fais un petit cours là dessus


    Il faut remplacer transcription, par TRADUCTION, merci de ne pas confondre c'est deux etapes totalement différentes!!!...

    Yoyo

  22. #21
    Yoyo

    Re : DM 1ère S biologie

    Citation Envoyé par nayeki
    Le premier codon est toujours ATG c'est celui-la qu'il faut trouver


    GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAAC
    CCATACAAGGACCTTTGGATTGCTACATTG AAGAGCCGTCGATCCGTATTG

    ici

    ATG ATC CAG CAAA CCT AAC GAT GTA ACA ACT CCG CAG CTA GGC ATA ACC CAT ACA AGG ACC TTT GGA TTG CTA CAT TGA AGA GCC GTC GAT CCG TAT TG
    une erreur qui provoque un décalage du cadre de lecture et donc qui te donne la mauvaise séquence!.. tu fais du frameshift sans le savoir

    Yoyo

  23. #22
    piwi

    Re : DM 1ère S biologie

    enorme erreur!!!!
    Impardonnable.
    sorry!...
    Merci de la corriger.

    !!!!!!TRADUCTION!!!!!!



    j'y suis pas moi. Vais retourner à mon apoptose chez les mouches (y a des jours je vous jure....)

  24. #23
    Yoyo

    Re : DM 1ère S biologie

    Citation Envoyé par gi-gi
    merci pour toutes vos réponses

    mais le problème c'est que en prenant le deuxième ou le premier brin comme transcrit (c'est à dire que l'ARNm est une copie du non transcrit sauf les T) eh bien l'on tombe sur un codon stop or dans l'exercice on doit trouver de la sérine.
    Je voulais savoir aussi pourquoi dans le gène de l'exercice les A, C, T ne sont pas tout le temps complémentaires avec un autre A C T des fois on a A-A ou T-T ou C-C ...

    @+
    gi-gi
    A mon humble avis ton brin 1 est correcte, mais le brin 2 est faux (message 14). Au niveau ADN tu n'as pas ce genre d'interactions dites "non watson-Crick"...

    En ce basant uniquement sur ton brin 1 alors voici la séquence :

    brin1: 5' GGTATGATCCAGCAAACCTAACGATGTAAC AACTCCGCAGCTAGGCATAACG 3'
    Brin2: 3' CCATACTAGGTCGTTTGGATTGCTACATTG TTGAGGCGTCGATCCGTATTGC 5'

    dans ce cas la le codon ATG que tu cherches est indiqué en GRAS. Donc le brin transcrit est l'opposé.
    LA séquence de ton ARNm est (AUG en gras):
    5' CGUUAUGCCUAGCUGCGGAGUUGUUACAUCGUUAGGU UUGCUGGAUCAUACC 3'
    La séquence en protéine te donne donc :
    Met Pro Ser Cys Gly Val Val Thr Ser Leu Gly Leu Leu Asp His Thr

    Bon courage
    Yoyo

  25. #24
    nayeki

    Re : DM 1ère S biologie

    Citation Envoyé par Yoyo
    une erreur qui provoque un décalage du cadre de lecture et donc qui te donne la mauvaise séquence!.. tu fais du frameshift sans le savoir

    Yoyo
    C'est mon cote geneticien

    C'est ca l'evolution

    A+

Discussions similaires

  1. Licence de Biologie ou DUT génie biologie ??
    Par elo021 dans le forum Orientation après le BAC
    Réponses: 5
    Dernier message: 05/12/2007, 09h17
  2. cherche un correspondant ou parrain pour des cours de biologie 1ère année
    Par pioline72 dans le forum Orientation après le BAC
    Réponses: 5
    Dernier message: 29/10/2007, 12h54
  3. Réponses: 12
    Dernier message: 24/07/2007, 23h49
  4. Redoublement : 1ère S > 1ère ES ou 1ère STG ?
    Par Menzakin dans le forum Orientation avant le BAC
    Réponses: 1
    Dernier message: 05/06/2007, 19h07
Découvrez nos comparatifs produits sur le sport et la santé : thermomètre médical, soins personnels...