Répondre à la discussion
Affichage des résultats 1 à 5 sur 5

la transcription et la traduction à partir d'une séquence en bases



  1. #1
    Cecilouche

    la transcription et la traduction à partir d'une séquence en bases


    ------

    Bonjour!
    Alors moi je demande de l'aide pour un de mes sujets de partielles, que je n'ai pas su résoudre. J'espère que quelqu'un pourra m'aider!
    La prof nous a donné cette séquence:
    5'GCTTGACGCTGTAAGGTTTTTGTAATTT TACAGGC[A]ACCTTTTATTCACTAACAAATAGCT[rbs]ATTATATGACT/.../AAATAAATC//3'
    3'CGAACTGCGACATTCCAAAAACATTAAA ATGTCCG T TGGAAAATAAGTGATTGTTTATCGA[rbs]TAATATACTGA/.../TTTATTTAG//5'
    Le A entre crochet est le codon +1 et le RBS entre crochet est le ribosome binding site.
    Il fallait ecrire la séquence en bases de l'ARNm du gène et la séquence partielle en Acides aminés.
    Sauf que je ne sais pas quel brin prendre pour transcrire l'ARN, dans quel sens le lire (la boîte TATA est à droite du +1!) bref je n'ai rien su faire!
    Je demande donc de l'aide car évidemment je vais devoir aller aux rattrapages et il va certainement falloir résoudre le même genre d'exercice!
    Merci beaucoup beaucoup d'avance à la personne qui me répondra!

    -----

  2. Publicité
  3. #2
    LXR

    Re : la transcription et la traduction à partir d'une séquence en bases

    Bonjour et bienvenue sur FSG,

    Déjà on ne dit pas le codon +1 mais le point +1 qui est la base à partir de laquelle débute la transcription d'un gène. Donc l'écriture de la séquence de l'ARNm commence à partir de ce point, donc 5'-AACCUUUUAUUCAC/.../UAAAUC-3'. Ensuite, au RBS suit un ATG d'initiation de la traduction, celui de cet exercice est situé 6 bases après le site RBS. Pour le sens de la traduction, il est définit par le sens dans lequel la transcription a été réalisée sur l'ADNg. Il faut donc considérer le brin où le point +1 est indiqué, c'est donc le brin du dessus. Pour l'exercice il ne se sont pas embêté à mettre tous les codons, ils n'ont mis que celui suivant le codon d'initiation ainsi que le codon précédant le codon stop (TAA), le but est de voir si vous avez compris. Donc la partie à traduire grâce au code génétique est ATGACT/.../AAAstop.

    Greg

  4. #3
    Cecilouche

    Re : la transcription et la traduction à partir d'une séquence en bases

    Merci beaucoup!
    Mais du coup l'ARNm est beaucoup plus long que la séquence à traduire en protéine si j'ai bien compris?Et c'est la ligne du haut à partir de +1 qui est transrite c'est cela?Mais dans ce cas pourquoi la boîte TATA est à droite de +1? Et L'ARNm est transcrit dans le sens 3'-5' non? Je m'embrouille complètement dans le sens des séquences.. Merci de votre patience!

  5. #4
    LXR

    Re : la transcription et la traduction à partir d'une séquence en bases

    L'ARNm est toujours plus long que la protéine qu'il code. C'est pour cela qu'on parle de partie 5'-UTR et 3'-UTR (UTR = untranslated region = région non traduite). Bref, je ne veux pas vous embrouiller plus. On place le point +1 sur le brin codant, cela facilite la lecture et les analyses, sinon il faudrait complémenter le brin matrice pour avoir la séquence codante, complexification inutiles. Donc c'est bien le brin du bas qui est copié par l'ARN polymérase (brin du bas = brin matrice), vu que le recopiage se fait par complémentarité, l'ARNm ainsi synthétisé correspond à la séquence du brin du haut (brin du haut = brin codant). Par contre, ne vous focaliser pas sur la recherche d'une séquence consensus comme la boite TATA, cela ajoute une complexité inutile pour répondre à cet exercice. Il faut commencer par le plus simple avant tout, et si on ne trouve toujours pas, aller chercher des éléments de réponse plus complexes. Ici, on vous donne le point +1 et le départ de la recherche de l'ATG d'initiation (en 3' du RBS) sur un plateau d'argent, cela suffit amplement à répondre aux questions posées.

    Une petite remarque, la séquence TATAA qui est le meilleur consensus de la boite TATA est communément retrouvé dans les séquences d'ADN, cela ne veut pas forcément dire que c'est une TATA box.

    Greg

  6. #5
    Cecilouche

    Re : la transcription et la traduction à partir d'une séquence en bases

    Merci beaucoup j'ai tout compris! Ca va vraiment m'aider! Merci!

  7. A voir en vidéo sur Futura

Discussions similaires

  1. [Biologie Moléculaire] Traduction et transcription
    Par ziedchelli dans le forum Biologie
    Réponses: 8
    Dernier message: 06/05/2009, 19h16
  2. [Biologie Cellulaire] séquences d'initiation transcription/traduction
    Par wmnzr dans le forum Biologie
    Réponses: 1
    Dernier message: 03/01/2009, 20h54
  3. [Génétique] transcription/traduction et polycistronie (procaryotes)
    Par elims dans le forum Biologie
    Réponses: 2
    Dernier message: 25/09/2007, 20h21
  4. structure 3D à partir d'une séquence
    Par arthurette dans le forum Biologie
    Réponses: 1
    Dernier message: 05/03/2007, 23h21
  5. Transcription et traduction des gènes
    Par jess88 dans le forum Biologie
    Réponses: 4
    Dernier message: 15/12/2006, 00h22