Répondre à la discussion
Affichage des résultats 1 à 6 sur 6

estimation de la taille d'une séquence d'adn



  1. #1
    mkh

    Question estimation de la taille d'une séquence d'adn


    ------

    bonjour,
    j'ai besoin de savoir la taille de cette séquence d'adn EN pb pour effectuer une pcr
    ATTCGGTTAAGGTTCCAATCGATAGTATAC GGTATCGTATGGC
    pouvez vous donner la formule qui me permettrait d'estimer la taille de cette séquence en pb et vos sources s'il vous plait je n'ai pas trouvé ça dans des articles.
    merci
    cordialement,
    mkh

    -----

  2. Publicité
  3. #2
    malesore

    Re : estimation de la taille d'une séquence d'adn

    La taille de ton fragment correspond tout simplement au nombre de nucléotides ... Un nucléotide équivaut à 1 pb ...
    Seul l'étang calme reflète les étoiles

  4. #3
    mkh

    Re : estimation de la taille d'une séquence d'adn

    s'il vous plait quelles sont vos sources?

  5. #4
    mkh

    Re : estimation de la taille d'une séquence d'adn

    j'ai besoin de la référence s'il vous plait

  6. A voir en vidéo sur Futura
  7. #5
    malesore

    Re : estimation de la taille d'une séquence d'adn

    Je n'ai pas de référence à te donner, c'est une convention, comme le mètre, le litre ...
    Seul l'étang calme reflète les étoiles

  8. #6
    kamor

    Re : estimation de la taille d'une séquence d'adn

    pb = paire de bases (dans un ADN double brin).
    Autrement dit on compte le nombre de bases A, T, C et G présent dans un des brins et on a le nombre de pb du double brin correspondant.

  9. Publicité

Discussions similaires

  1. [Biochimie] estimation de le concentration d'ADN aprés spectrophotometrie
    Par hanaeuh dans le forum Biologie
    Réponses: 5
    Dernier message: 28/02/2012, 17h12
  2. [Exercice] Séquence d'ADN modifié
    Par Yayaslim dans le forum Biologie
    Réponses: 8
    Dernier message: 07/11/2010, 19h50
  3. Bioinformatique - Etudes d'une sequence d'ADN
    Par Barbanath dans le forum Biologie
    Réponses: 10
    Dernier message: 17/10/2010, 20h57
  4. [Biochimie] Comment décrire une séquence d'ADN?
    Par manousteph dans le forum Biologie
    Réponses: 8
    Dernier message: 16/02/2010, 21h51
  5. estimation de la taille d'une population
    Par thebluest dans le forum Mathématiques du supérieur
    Réponses: 0
    Dernier message: 05/01/2005, 10h56
Découvrez nos comparatifs produits sur le sport et la santé.