Répondre à la discussion
Affichage des résultats 1 à 3 sur 3

Amplification d'un gène par PCR : choix des amorces



  1. #1
    dams7325

    Amplification d'un gène par PCR : choix des amorces


    ------

    Bonjour,

    Je dois choisir les amorces Forward et Reverse pour amplifier la totalité du gène GAI (1500pdb) dont les codons initiateur et stop sont respectivement, ATG et TAG (soulignés dans la séquence).

    Voici la séquence : les deux amorces à utiliser doivent faire 20 nucléotides et le fragment amplifié doit être le plus court possible tout en contenant le codon initiateur et le codon stop.

    Du coup j'hésite entre plusieurs possibilités, soit je commence directement l'hybridation par le codon initiateur et le codon stop, soit je laisse un nucléotide de marge (je commence par c puis continue par ATG... pour le codon initiateur, idem pour le codon stop, soit j'hybride 20 nucléotides avant le codon initiateur et 20 nucléotides après le codon stop (quand on lit la séquence de gauche à droite) car il faut en général encadrer le gène.
    Qu'en pensez-vous?
    Merci d'avance.

    Voici la séquence avec en majuscule la séquence de GAI.


    5’tttgttattagaagtggtagtggagtga aaaaacaaatcctaagcagtcctaaccgat ccccgaagctaaagattcttcaccttccca aataaagcaaaacctagatccgacattgaa ggaaaaaccttttagatccatctctgaaaa aaaaccaaccATGAAGAGAGATCATCATCATCATCATCATCAA GATAAGAAGACTATGATGATGAATGAAGAA GACGACGGTAACGGCATGGATGAGCTTCTA GCTGTTCTTGGTTACAAGGTTAGGTCATCC GAAATGGCTGATGTTGCTC/……/TCAACGGCGGTGAGGGTTATCGGGTGGAGG AGAGTGACGGCTGTCTCATGTTGGGTTGGC ACACACGACCGCTCATAGCCACCTCGGCTT GGAAACTCTCCACCAATTAGatggtggctcaatgaattgatctgttgaac cggttatgatgatagatttccgaccgaagc caaactaaatcctactgtttttccctttgt cacttgttaagatcttatctttcattatat taggtaattgaaaaattttaatctcgcttt ggagagttttttttttttgcatgtgacatt ggagggta3’

    -----

  2. #2
    Flyingbike

    Re : Amplification d'un gène par PCR : choix des amorces

    Bonjour


    Je dirais que le choix des amorces dépend de ce que tu veux faire après la PCR. Si c'est du clonage, ca dépendra de si on veut un simple cDNA, de si on souhaite faire une protéine de fusion, etc...

  3. #3
    dams7325

    Re : Amplification d'un gène par PCR : choix des amorces

    Bonsoir,

    Il s'agit juste d'un exercice théorique, mais je pense plus qu'il faut hybrider l'amorce 20 nucléotides avant le codon initiateur et idem pour le codon stop car une amorce comme son nom l'indique sert à amorcer la polymérase et du coup on attaque directement par le codon initiateur / stop.

Sur le même thème :

Discussions similaires

  1. [Licence (L1-L2-L3)] Choix des amorces pour une PCR
    Par little_canard dans le forum Exercices en biologie
    Réponses: 5
    Dernier message: 03/04/2016, 11h11
  2. Technique pCR choix amorces
    Par gadouille dans le forum Biologie
    Réponses: 3
    Dernier message: 22/11/2011, 16h00
  3. [Biologie Moléculaire] amplification en aval d'un gène
    Par radiopharmaceutique dans le forum Biologie
    Réponses: 1
    Dernier message: 13/04/2011, 09h36
  4. [Biologie Moléculaire] choix des amorces
    Par OULD HAMOUDA dans le forum Biologie
    Réponses: 3
    Dernier message: 07/04/2011, 14h58
  5. [Biologie Moléculaire] Choix des amorces de la PCR
    Par hollsiwasam dans le forum Biologie
    Réponses: 5
    Dernier message: 18/01/2010, 08h02