Répondre à la discussion
Affichage des résultats 1 à 4 sur 4

[Biochimie] Acides nucléiques et ADN



  1. #1
    pndi

    [Biochimie] Acides nucléiques et ADN

    Bonjour, je suis en pleine révision de biochimie mais je bute sur quelques exercices. Est-ce que vous pourriez m'éclairer ou m'indiquer sur la bonne voie ? Ce n'est pas la matière que je maitrise le plus. :/ Merci d'avance pour votre aide.

    Une solution contenant un mélange d'AMP et de GMP possède une absorption de 0,652 à 260 mm et de 0,284 à 280 nm. Connaissant les coefficients d'absorption molaire donnés ci
    -dessous, calculer les concentrations respectives de l'AMP et du GMP dans la solution (épaisseur de la cuve = 1 cm).
    AMP :ε260= 15,4*10^3 L/mol/cm
    GMP :ε260= 11,7*10^3 L/mol/cm
    AMP :ε280= 2,5*10^3 L/mol/cm
    GMP :ε280= 7,7*10^3 L/mol/cm
    En reprenant la formule de l'absorbance, j'arrive à C=A/(ε*l). J'en ai déduis ces 4 équations : C(AMP260)=0,652/(15,4*10^3*1), C(GMP260)=0,652/(11,7*10^3*1), C(AMP280)=0,284/(2,5*10^3*1) et C(GMP280)=0,284/(7,7*10^3). Je pensais qu'il fallait seulement garder la première et la dernière équation vu les données présentées au début de l'énoncé... je ne suis pas sur d'avoir bien compris ce qui est demandé.


    Soit la séquence d’ADN suivante 5’-GTATCGTGGC-3’.
    Avec quel acide nucléique ci-dessous cet ADN peut-il s’associer ?
    a) 5’-CAUAGCACCG-3’ b) 5’-GCCACGATAC-3’ c) 5’-GCCACGAUAC-3’
    En se basant sur l'appariement de bases (A=>T, C=>G), l'acide a) me semblait être celui avec lequel l'ADN peut s'associer. Après m'être rendu compte qu'il contenait de l'uracile, j'en ai déduis que ce n'était pas le bon et que la seule réponse valable était la b). Si j'ai bien compris, pour cette proposition, on lit la séquence de 3' vers 5' pour la comparer avec la séquence d'ADN lue de 5' à 3', ou bien ai-je oublié de prendre d'autres paramètres en compte ?


    La séquence suivante contient la région codante d’un gène humain. ADN ou ARN ?
    5’- AAGAATGGAAGCTGTGAAGTCG(NNN)nTT TGCAAATATATGACAC -3’
    a) Quelle est la séquence générée par réplication utilisant ce brin comme matrice ? Type moléculaire ? Où et quand a lieu la synthèse ? Par quoi est assurée la réaction ?
    b) Quelle est la séquence générée par transcription à partir du brin défini en (a) ? Type moléculaire? Où et quand a lieu la synthèse ? Par quoi est assurée la réaction ?
    c) Quelle est la séquence générée par traduction à partir du brin défini en (b) ? Type moléculaire ? Où et quand a lieu la synthèse ? Par quoi est assurée la réaction ?
    d) Le produit de traduction est-il le même :
    - si le triplet GAA codant est éliminé ?
    - si le G de ce triplet GAA est éliminé ?
    - si le G de ce triplet est muté en T ?
    - si le G de ce triplet est muté en A ?
    - si le A en 3e position de ce triplet est muté en G ?
    e) Quelles pourraient en être les conséquences sur la cellule ou l’organisme ?codeG.jpg
    C'est la première fois que je me retrouve à interpréter une séquence à partir du code génétique, et j'avoue être complètement perdu. Quelqu'un pourrait-il m'aiguiller ?

    -----

    Dernière modification par pndi ; 09/05/2014 à 16h40.

  2. #2
    pndi

    Re : [Biochimie] Acides nucléiques et ADN

    Je relance en espérant qu'une ame charitable puisse aider l'étudiant confu que je suis sur cette matière.

  3. #3
    sebastien_cha

    Re : [Biochimie] Acides nucléiques et ADN

    Bonjour,
    réponses en rouge dans la suite

    Bonjour, je suis en pleine révision de biochimie mais je bute sur quelques exercices. Est-ce que vous pourriez m'éclairer ou m'indiquer sur la bonne voie ? Ce n'est pas la matière que je maitrise le plus. :/ Merci d'avance pour votre aide.

    Une solution contenant un mélange d'AMP et de GMP possède une absorption de 0,652 à 260 mm et de 0,284 à 280 nm. Connaissant les coefficients d'absorption molaire donnés ci
    -dessous, calculer les concentrations respectives de l'AMP et du GMP dans la solution (épaisseur de la cuve = 1 cm).
    AMP :ε260= 15,4*10^3 L/mol/cm
    GMP :ε260= 11,7*10^3 L/mol/cm
    AMP :ε280= 2,5*10^3 L/mol/cm
    GMP :ε280= 7,7*10^3 L/mol/cm
    En reprenant la formule de l'absorbance, j'arrive à C=A/(ε*l). J'en ai déduis ces 4 équations : C(AMP260)=0,652/(15,4*10^3*1), C(GMP260)=0,652/(11,7*10^3*1), C(AMP280)=0,284/(2,5*10^3*1) et C(GMP280)=0,284/(7,7*10^3). Je pensais qu'il fallait seulement garder la première et la dernière équation vu les données présentées au début de l'énoncé... je ne suis pas sur d'avoir bien compris ce qui est demandé.
    La concentration pour les acides nucleiques se mesure à 260nm le rapport A260/A280 est utilisé pour en déterminer la pureté

    Soit la séquence d’ADN suivante 5’-GTATCGTGGC-3’.
    Avec quel acide nucléique ci-dessous cet ADN peut-il s’associer ?
    a) 5’-CAUAGCACCG-3’ b) 5’-GCCACGATAC-3’ c) 5’-GCCACGAUAC-3’
    En se basant sur l'appariement de bases (A=>T, C=>G), l'acide a) me semblait être celui avec lequel l'ADN peut s'associer. Après m'être rendu compte qu'il contenait de l'uracile, j'en ai déduis que ce n'était pas le bon et que la seule réponse valable était la b). Si j'ai bien compris, pour cette proposition, on lit la séquence de 3' vers 5' pour la comparer avec la séquence d'ADN lue de 5' à 3', ou bien ai-je oublié de prendre d'autres paramètres en compte ? réponse b car ADN s'associe de manière anti-parallèle


    La séquence suivante contient la région codante d’un gène humain. ADN ou ARN ?
    5’- AAGAATGGAAGCTGTGAAGTCG(NNN)nTT TGCAAATATATGACAC -3’
    a) Quelle est la séquence générée par réplication utilisant ce brin comme matrice ? Type moléculaire ? ADNOù et quand a lieu la synthèse ? dans le noyau lors de la division cellulaire Par quoi est assurée la réaction ?ADN polymérase, hélicase,...
    TTCTTACCTTCGGAC...
    b) Quelle est la séquence générée par transcription à partir du brin défini en (a) ? Type moléculaire? ARNOù et quand a lieu la synthèse ? Dans le noyau lors de la synthèse protéiquePar quoi est assurée la réaction ? ARN polymerase
    UUCUUACC...
    c) Quelle est la séquence générée par traduction à partir du brin défini en (b) ? Voir le code génétique pour la traductionType moléculaire ?Protéine Où et quand a lieu la synthèse ? Par quoi est assurée la réaction Dans le cytoplasme au niveau des ribosomes + ARNt + Acides aminées?
    d) Le produit de traduction est-il le même :
    - si le triplet GAA codant est éliminé ? On garde la même phase de lecture mais il va manquer un acide aminé
    - si le G de ce triplet GAA est éliminé ?On modifie le cadre de lecture avec donc modification des acides aminés qui suivent p
    - si le G de ce triplet est muté en T ?Insertion d'un codon stop
    - si le G de ce triplet est muté en A ?On modifie l'Acide aminé
    - si le A en 3e position de ce triplet est muté en G ?Rien cela donne le même acide aminé
    e) Quelles pourraient en être les conséquences sur la cellule ou l’organisme ?En fonction de la mutation on peut avoir une protéine non présente et donc une maladie, une proteine non fonctionnelle ou fonctionnant moins bien--> maladie, pas d'effet si le même acide aminé

  4. #4
    pndi

    Re : [Biochimie] Acides nucléiques et ADN

    Merci beaucoup pour votre aide ! Ca me parait beaucoup plus claire. J'avais pas pensé au rapport A260/A280, que j'ai pourtant déjà utilisé en TP. Je viens de passer l'examen et j'ai eu un exercice basé sur des séquences d'ADN, que j'ai pu réussir grâce à vous. Encore merci !

Sur le même thème :

Discussions similaires

  1. [Biochimie] Enlever les acides nucléiques
    Par gex31 dans le forum Biologie
    Réponses: 5
    Dernier message: 27/03/2012, 15h17
  2. [Microbiologie] Archéobactérie et acides nucléiques.
    Par goubixx dans le forum Biologie
    Réponses: 20
    Dernier message: 12/01/2011, 17h22
  3. probleme en biochimie :les acides nucleiques
    Par kornus dans le forum Chimie
    Réponses: 0
    Dernier message: 16/05/2009, 18h47
  4. [Biochimie] exercice sur les acides nucléiques
    Par Cedricle100 dans le forum Biologie
    Réponses: 2
    Dernier message: 30/04/2009, 12h45
  5. Extraction d'acides nucléiques
    Par ggpessoa dans le forum Biologie
    Réponses: 4
    Dernier message: 15/01/2005, 20h29