Répondre à la discussion
Affichage des résultats 1 à 5 sur 5

Recherche de gène



  1. #1
    asouli

    Recherche de gène


    ------

    bonsoir à tous,
    j'ai un fragment de séquence avec son numéro et je cherche à quel gène il correspond donc comment je dois procéder, dois je aller sur Genebank et dans ce cas comment je procède exactement?
    c urgent j'ai 157fragments de séquences à determiner
    j'attends votre réponse merci beaucoup

    -----

  2. Publicité
  3. #2
    Vinc

    Re : recherche de gène

    Si t'as le numéro de la séquence tu vas dans GeneBank et tu rentres le numéro.....
    Primum non nocere.

  4. #3
    asouli

    Re : Recherche de gène

    oui j'ai fais comme ça mais il m'a pas sorti à quel gène appartient la séquence voila par exemple la séquence:
    Bornes du fragment:12310:13159 zone d’intérêt 12502..12661
    tgtttctgaagttcccaggactcacacacc cgttcccatctcacttgcccacccagtgtg
    acaaccctcggtgtggatatacccccgtgg actcatggctcttccccacccccactttct
    ataaatgtaggcctagaatacgcttctctg ttgcaaaactcagctaagttcctgcttcca
    ccttgatgttgaaatatcttatgtaagagg gcaggggatgtcgtgaagatggcaagaaga
    acacagtttcaaatttctggaaaagagcct gtggtggagatctaaagatgtttagggaag
    agctcgactaaagaacaatgaaataaatgg tccaaggggaagtcatatggctgttggtgt
    gatgttctttgctgcttcatagacacggcc tggagtgaggcaagccacacactgggccct
    cctggtcctgcagcccttgctgttctgggc acagggtctgggctctcagcataggtatct
    tgagggttcggaatccccaacacactcagc aactgcatattacatggccaccaccgaagg
    tcaagaccagtacccgcaataaagtctgac tatgttgttctgatggggttccccaggagc
    agagcctgagatgagcattcaggaacaagt gatttattgagaagtggccggcgcagtggc
    tcatgcctgtaacctcagcactttgggagg ccaaggcaggaggatcccttgagcccaaga
    gttccataccagcttaggcaacatagtgag acccccatctctataaaaaatttaaaaaat
    tagctgggcatggtggcacatgcctgtagt cccagctacttggggggaggctgaggcaag
    aggatcaact

  5. #4
    Annaick_R

    Re : Recherche de gène

    Salut,

    tu peux faire un BLAST de ta séquence contre la base de donnée Genbank.
    http://www.ncbi.nlm.nih.gov/blast/

    Tu auras toutes les séquences qui ressemblent à ta séquence. Avec un peu de chance, il y en aura une qui sera annotée: c'est à dire qu'il y aura le nom du gène ou de la protéine.

    C'est une séquence génomique (avec introns) ou d'ADNc (sans introns) ?

    Tu travailles sur quelle espèce ?

    Annaïck.

  6. A voir en vidéo sur Futura
  7. #5
    Annaick_R

    Smile Re : Recherche de gène = TROUVE!

    J'ai fait la manip pour toi : voila le résultat
    RID: 1141987286-8521-174161964029.BLASTQ4

    Ca serait le gène humain : PADI12346
    codant une peptidylarginine deiminase (à vérifier)

    Si tu en as 165 à faire, je te conseille de te rapprocher d'une personne qui s'y connait en bio-informatique et en annotation de gènes.

    Annaïck.

Discussions similaires

  1. [Génétique] Gène ?
    Par demonne dans le forum Biologie
    Réponses: 33
    Dernier message: 18/11/2007, 18h39
  2. la probabilité me gene
    Par NAGHAM dans le forum Mathématiques du supérieur
    Réponses: 11
    Dernier message: 13/04/2007, 22h05
  3. gene
    Par scholasticus dans le forum Biologie
    Réponses: 4
    Dernier message: 03/05/2006, 16h54
  4. Recherche de gène
    Par asouli dans le forum Santé et médecine générale
    Réponses: 0
    Dernier message: 09/03/2006, 20h43
Découvrez nos comparatifs produits sur le sport et la santé.