Répondre à la discussion
Affichage des résultats 1 à 10 sur 10

Choix amorces amplification portion ADN



  1. #1
    Coleacanthe

    Unhappy Choix amorces amplification portion ADN

    Bonjour à tous
    J'ai beaucoup (beaucoup) parcouru internet pour comprendre VRAIMENT le choix des amorces. A chaque fois je tombe sur des cours ou schémas bien faits, mais je ne comprends pas "concretement"
    J'ai un exo à faire, et je vous montre les amorces que j'ai choisies , pourrriez vous me dire si elles seraient ok?



    5' GAA TCC CAC GGT AAA TTG GAA CAC AAG 3' --> brin d'ADN
    5' CG CTCGAG CTT AGG GTG CCA TTT AAC 3'--> amorce avec 2 nucleotides au hasard, mon enzyme de restriction , et 18 nucléotides pour donner 26.

    3' CCC ACA TTG GTC TGT TCA 5' --> brin d'ADN anti-sens lu en inverse
    3'CG CTCGAG GGG TGT AAC CAG ACA AGT 5' --> amorce avec 2 nucleotides au hasard, enzyme, 18 nucleotides

    Je ne sais pas si je dois ajouter ATG et TAA pour un début et une fin, sachant qu'il y en a en plein fragment d ADN et que je ne suis meme pas sure qu'il en faille. Peut etre que je dois en ajouter s il n y en a aucun à l'interieur du fragment?amorces.JPG




    Et je me demandais aussi:
    - l'enzyme de restriction reconnait une séquence (souvent palindrome ) de l'ADN , s'y fixe, mais sous quelle forme est cette enzyme ( est-ce qu elle doit etre complémentaire du brin d'ADN , ou peut importe sa forme, elle reconnait le site, s'y fixe et ne doit pas s'apparier à l'ADN)?
    - Si j 'ai un fragment d'ADN à amplifier et que j ai un codon début et un codon stop au milieu du fragment, est-ce que je m'en fiche dans le cadre d'une amplification d'un fragment d'ADN? En gros, quand on me demande d amplifier un fragment, c est un fragment, sinon on m aurait demandé d'amplifier le gène?
    - Si je n'ai pas de codon ATG ou stop dans mon fragment, dois-je le rajouter dans ma séquence d'amorce? ( je crois que je fais une confusion entre l amplification et la traduction du gène)

    Merci à tous d'avance
    Et je vous mets donc mon exo et ma proposition d'amorces
    Bien cordialement

    -----


  2. Publicité
  3. #2
    Aqualung

    Re : Choix amorces amplificatin portion ADN

    Bonjour
    On t'indique que les amorces doivent faire 26 nucléotides et contenir des séquences de clivages XhoI CTCGAG

    Je repars du brin que tu avais proposé :

    5' GAA TCC CAC GGT AAA TTG GAA CAC AAG 3' --> brin d'ADN
    tu dois donc prendre (26 -6 nucléotides : 20, j'ai mis en rouge ce que tu dois enlever du brin matrice)

    Une fois le brin défini, tu prends la séquence complémentaire pour avoir la séquence de l'amorce voulue
    donc : CTT AGG GTG CCA TTT AAC CT voici les 20 premières nucléotides de ton amorce. A ça, tu rajoutes la séquence XhoI, du coté gauche pour l'avoir après la séquence à amplifier donc tu auras CTCGAGCTT AGG GTG CCA TTT AAC CT
    Et voilà ta première amorce.

    Même exercice pour la seconde, tu sélectionne 20 nucléotides finales de la séquence, donc : TGACT TGTCTGGTTA CACCC
    Tu n'as ici l'information que sur un brin d'ADN, la seconde amorce doit se poser sur le brin complémentaire au brin donné ici, tu dois donc réverser le brin : ACTGA ACAGACCAAT GTGGG.
    Maintenant que tu as le brin d'origine, tu peux dessiner l'amorce voulue : tu retrouves la séquence : TGACT TGTCTGGTTA CACCC
    A cette amorce, tu ajoutes, du coté droit, la séquence XhoI, tu auras donc TGACT TGTCTGGTTA CACCCCTCGAG
    Tu as maintenant tes deux amorces de 20 nucléotides, amplifiant ton brin et ajoutant des sites de clivages pour XhoI de part et d'autre.

    Pour tes questions, l'enzyme fonctionne dès qu'elle aperçoit la séquence voulue, peut importe la forme.
    Dans une PCR les codons STOP et ATG n'ont aucun intérêt, il s'agit ici d'amplifier de l'ADN indépendamment de sa séquence.

    Bonne journée
    Dernière modification par Aqualung ; 08/03/2016 à 09h37.

  4. #3
    Coleacanthe

    Re : Choix amorces amplificatin portion ADN

    Bonjour
    Tout d'abord merci beaucoup !! Je comprends la logique. Par contre je me suis posé une autre question:
    L'ADN polymérase lit le brin de 3' en 5'?

    Merci
    bonne journée !

  5. #4
    Coleacanthe

    Re : Choix amorces amplificatin portion ADN

    Re bonjour
    En fait, je pense ne pas voir tout compris
    Je m'explique


    j'ai mon brin d' ADN de 5' en 3'

    5' GAA TCC CAC GGT AAA TTG GA ... TGA CT TGTCTGGTTA CACCC 3' --> brin d'ADN A

    et je dessine son complémentaire qui n'est pas donné dans mon exo

    3' CTT AGG GTG CCA TTT AAC CA... ACT GA ACAGACCAAT GTGGG 5' complémentaire B

    Je sais que mon ADN polymerase a besoin d'amorce et lit de 3' en 5 ' pour synthétiser de 5' en 3'

    donc je commence par mon brin complementaire B
    lui, sera lu de 3' en 5' et sera synthétisé son complémentaire donc

    3' CTT AGG GTG CCA TTT AAC CA 5' complémentaire B
    5' GAA TCC CTC GGT AAA TTG GT 3' ( brin supposé synthétisé par l'ADN pol) donc mon amorce est 5' CTC GAG (enzyme) puis GAA TCC CTC GGT AAA TTG GT3'

    Je cherche l'amorce pour A
    5' TGA CT TGTCTGGTTA CACCC 3'
    3' ACT GA ACAGACCAAT GTGGG 5'
    j'inverse le complémentaire pour qu'elle lise dans l'autre sens
    avec l'enzyme 5'CTC GAG GGG TGTA ACC AGA CAA GTC A 3'

    Mes 2 amorces
    5' CTC GAG GAA TCC CTC GGT AAA TTG GT3'
    5'CTC GAG GGG TGTA ACC AGA CAA GTC A 3'


    Est-ce que je me trompe completement?

  6. #5
    Aqualung

    Re : Choix amorces amplificatin portion ADN

    Tu compliques fort les choses, il faut rester simple.
    En résumé, pour l'amorce 1, tu commences par l'extrémité 5' du brin proposé ici, et tu dessines l'amorce en prenant la séquence complémentaire à celle proposée, tu auras donc CTT AGG GAG CCA TTT AAC CA
    Pour la seconde amorce, qui doit se fixer sur le brin B, tu devras prendre le complémentaire, du complémentaire du brin proposé, en résumé tu prends simplement la séquence proposée directement (si tu l'inverse 2 fois, tu reviendras à celle-ci), en comptant 20 nucléotides à partir de l'extrémité 3' : tu auras TGACT TGTCTGGTTA CACCC

    Si tu travailles avec uniquement ça, tu auras ta séquence amplifiée. Il faut ensuite ajouter les sites de clivage. A l'amorce 1, tu l'ajoutes à gauche (du coté 5') et à l'amorce 2 tu l'ajoute à droite (du coté 3') et tu te retrouve avec les séquences que j'ai proposé plus haut.

  7. A voir en vidéo sur Futura
  8. #6
    Coleacanthe

    Re : Choix amorces amplificatin portion ADN

    Désolée de sembler compliquer les choses, ce n est pas que je le veuille , c est que j ai du mal à comprendre si je ne comprends pas toutes les étapes.
    Quand tu dis
    5' GAA TCC CAC GGT AAA TTG GA

    pour l'amorce 1, tu commences par l'extrémité 5' du brin proposé ici, et tu dessines l'amorce en prenant la séquence complémentaire à celle proposée, tu auras donc CTT AGG GAG CCA TTT AAC CA , mais ca ne gene pas le sens de lecture de l'ADN pol qui lit de 3' en 5 ' ? parce que selon ton amorce, elle vient bien se fixer sur l'amorce mais après son "sens de lecture" sera de 5' en 3', non?

  9. Publicité
  10. #7
    Aqualung

    Re : Choix amorces amplificatin portion ADN

    Bonjour, aucun soucis, ce n'était pas un reproche

    Je comprends ce qui te tracasse maintenant. Donc en effet les polymérases vont de 5' vers 3' selon le sens de l'amorce (et non le sens du brin matrice!)
    Si l'amorce 1 a cette séquence : 5' - CTCGAGCTT AGG GTG CCA TTT AAC CT - 3', la polymérase démarera donc à gauche et ira vers la droite. Ta confusion vient du fait que tu te base sur le sens du brin matrice, et du coup tu as l'impression que la polymérase va de 3' vers 5'

  11. #8
    Coleacanthe

    Re : Choix amorces amplificatin portion ADN

    ok , merci beaucoup

  12. #9
    DocBrownd

    Re : Choix amorces amplification portion ADN

    Bonjour,
    bon on est 10 jours plus tard, donc j'arrive après la bataille, mais il y a un problème avec les explications données.
    En effet cette réponse :

    Mes 2 amorces
    5' CTC GAG GAA TCC CTC GGT AAA TTG GT3'
    5'CTC GAG GGG TGTA ACC AGA CAA GTC A 3'


    Est-ce que je me trompe completement?
    est (presque) correcte.


    Celle fournie par Aqualung ne l'est malheureusement pas


    Une manière simple de designer des oligo s'est de se fier au sens 5'-3' et surtout de dessiner la séquence attendue :

    dans cette exercice, on souhaite ajouter en 5' et 3' la séquence reconnue par XhoI soit 5'-CTCGAG-3'
    Donc la séquence attendue est :

    5' - CTCGAG GAATCCCACGGTAAA///////GGTTACACCC CTCGAG - 3'
    3' - GAGCTC CTTAGGGTGCCATTT////////CCAATGTGGG GAGCTC - 5'


    Maintenant pour amplifier cette séquence, il faut savoir que la matrice est forcément 5'-> 3' afin que la polymérase ait une extrémité 3'-OH libre pour les réactions de plymérisation

    Donc pour amplifier le premier brin, notre amorce 5'->3' ne peut s'hybrider que sur le brin complémentaire :

    5' amorce 3'
    3' - GAGCTC CTTAGGGTGCCATTT////////CCAATGTGGG GAGCTC - 5'


    cette amorce est donc complémentaire au brin complémentaire, donc identique au brin sens, et comme elle doit faire 26 nucléotides en comptant les 6 de XhoI, on obtient :


    5' - CTCGAG GAATCCCACGGTAAATTGGA - 3' (dans la réponse de Coleacanthe il y a un T à la place du dernier A)


    Pour la seconde amorce, meme principe : elle est forcément 5'->3' :


    5' - CTCGAG GAATCCCACGGTAAA///////GGTTACACCC CTCGAG - 3'
    3' - GAGCTC CTTAGGGTGCCATTT////////CCAATGTGGG GAGCTC - 5'


    donc elle ne peut s'hybrider que sur le brin sens :


    5' - CTCGAG GAATCCCACGGTAAA///////GGTTACACCC CTCGAG - 3'
    3'<- amorce - 5'


    Elle est donc complémentaire au brin sens ou identique au brin complémentaire :


    3'-ACTGAACAGACCAATGTGGG GAGCTC-5'


    sauf que les conventions d'écriture fait qu'on donne toujours une séquence avec l'extrémité 5' à gauche :


    5'-CTCGAG GGGTGTAACCAGACAAGTCA-3'


    on a donc comme amorce :

    5' - CTCGAG GAATCCCACGGTAAATTGGA - 3'

    5'-CTCGAG GGGTGTAACCAGACAAGTCA-3'

    il faut simplement se souvenir que la polymérase ne peut polymériser qu'à partir d'une extrémité 3'-OH libre et qu'elle va donc libre la séquence du brin qu'elle copie vers l'extrémité 5' de ce brin

    5' - amorce -3' -------------->
    3' - brin --------------------------------- - 5'


    5' - brin --------------------------------- - 3'
    <------------ 3' - amorce - 5'



    Voilà j'espère que ça en aidera quelque uns
    Dernière modification par DocBrownd ; 18/03/2016 à 16h43.

  13. #10
    Coleacanthe

    Smile Re : Choix amorces amplification portion ADN

    Bonsoir
    Merci pour ces eclaircissements !!

Sur le même thème :

Discussions similaires

  1. choix des amorces
    Par touriader dans le forum Biologie
    Réponses: 0
    Dernier message: 26/03/2014, 21h28
  2. [Microbiologie] Amplification d'un gène par PCR : choix des amorces
    Par dams7325 dans le forum Biologie
    Réponses: 2
    Dernier message: 18/11/2013, 18h31
  3. Technique pCR choix amorces
    Par gadouille dans le forum Biologie
    Réponses: 3
    Dernier message: 22/11/2011, 16h00
  4. [Biologie Moléculaire] choix des amorces
    Par OULD HAMOUDA dans le forum Biologie
    Réponses: 3
    Dernier message: 07/04/2011, 14h58
  5. [Biologie Moléculaire] Choix des amorces de la PCR
    Par hollsiwasam dans le forum Biologie
    Réponses: 5
    Dernier message: 18/01/2010, 08h02