Répondre à la discussion
Affichage des résultats 1 à 2 sur 2

comment crée un site de restriction pour une enzyme

  1. #1

    comment crée un site de restriction pour une enzyme


    Bonjour t le monde,
    s'il vous plait aidez moi à crée un site de restriction de l'enzyme DraI qui coupe dans la région palindromique TTTAAA
    L'amorce (primer) R est le suivant :
    5"ccttccttctttttgattttgttt 3" après le reversement donne aaacaaaatcaaaaagaaggaagg
    nous voulons amplifier l'exon 7 de ce gène
    EXON 1 244 bp
    EXON 2 72 bp
    EXON 3 120 bp
    EXON 4 201 bp
    EXON 5 153 bp
    EXON 6 96 bp
    EXON 7 111 bp
    EXON 8 54 bp
    EXON 9 572 bp

    La séquence AGACTATCAACTTAATTTCTGATCA sur l’intron 8 correspond au site de fixation de l’morce F : agactatcaacttaatttctgatca


  2. #2

    Re : comment crée un site de restriction pour une enzyme

    Okay, j'ai absolument rien compris. Si tu veux qu'on t'aide, t'as intérêt à faire un effort de clarté.

    Tu veux mettre le site en 5' ou 3' de ton amplicon ? D'ailleurs tu peux mettre l'amplicon en gras, c'est hyper chiant à visualiser comme ça. Ah et vire les exons 1-6 et 9, on s'en fou.
    Dernière modification par Tibosax ; 02/07/2016 à 19h04.

Sur le même thème :

Discussions similaires

  1. [Biologie Cellulaire] Enzyme de restriction
    Par Lauu.p dans le forum Biologie
    Réponses: 12
    Dernier message: 25/05/2015, 02h14
  2. [Biologie Moléculaire] Enzyme de restriction
    Par wmnzr dans le forum Biologie
    Réponses: 4
    Dernier message: 02/02/2009, 19h52
  3. [Biologie Cellulaire] enzyme de restriction
    Par pommederennette dans le forum Biologie
    Réponses: 12
    Dernier message: 27/12/2007, 22h20
  4. [Biochimie] enzyme de restriction
    Par bionadir dans le forum Biologie
    Réponses: 1
    Dernier message: 07/12/2007, 08h55
  5. software pour crée un site
    Par vampyer972 dans le forum Logiciel - Software - Open Source
    Réponses: 3
    Dernier message: 04/01/2006, 18h58