Répondre à la discussion
Affichage des résultats 1 à 6 sur 6

génétique moléculaire



  1. #1
    mina09

    génétique moléculaire


    ------

    bonjour
    dans mon exo on me demande de faire un schema des etapes de synthese d'un ADNcomplementaire en citant les enzymes et cosubstrats avec comme gene:
    3' AATTACGATCAACGTGACCCTGAA 5'
    5' TTAATGCTAGTTGCACTGGGACTT 3'
    est ce qu'il me faut decrire une transcription?

    -----

  2. Publicité
  3. #2
    mina09

    Re : genetique moleculaire

    il n'y a personne qui peut m'aider svp?

  4. #3
    Annaick_R

    Re : genetique moleculaire

    Bonjour,

    La synthèse d'un ADN complémentaire consiste à obtenir la séquence ADN double brin correspondant à un ARN messager.

    Elle se fait en 2 étapes : tout d'abord, une transcriptase inverse (enzyme) permet de synthétiser une molécule d'ADN simple brin à partir d'une molécule d'ARN.
    Puis, le second brin d'ADN est synthétisé grâce à une autre enzyme qui synthétise le brin complémentaire (ADN synthase ?)

    En partant du gène, il faut indiquer l'étape de transcription qui permet d'obtenir l'ARN messager mais je ne crois pas qu'il y a besoin de détailler cette étape.
    En effet, quand on veut synthétiser des ADNc au labo, on part généralement d'une préparation d'ARN.
    On peut aussi partir d'une préparation d'ADN mais dans ce cas, il faut réaliser une transcription in vitro, ce qui est assez lourd techniquement.

    Voilà, j'espère que ça va t'éclairer un peu pour ton exercice.

    Annaïck.

  5. #4
    mina09

    Re : genetique moleculaire

    desolee annaick merci de ta reponse mais malheureusement je ne comprends rien

  6. #5
    Annaick_R

    Re : genetique moleculaire

    Bon, je vais essayer de faire plus simple:

    1-TRANSCRIPTION
    ADN double brin -> ARN messager (simple brin, séquence avec des U à la place des T)

    2-TRANSCRIPTION INVERSE
    ARN messager -> ADN complémentaire simple brin (séquence complémentaire avec des T à la place des U)

    3-SYNTHESE DU 2eme BRIN de l'ADNc
    ADNc simple brin -> ADNc double brin (même séquence exactement que le gène de départ (normal c'est le but recherché)

    Donc d'un seul morceau ça fait :

    ADN (gène)->ARNm->ADNc simple brin->ADNc double brin

    Est-ce que ça te parle plus ?
    Quel est ton niveau d'étude ? Ca m'aiderai pour choisir ma réponse.

    Annaïck

  7. A voir en vidéo sur Futura
  8. #6
    mina09

    Re : genetique moleculaire

    merci annaick. en fait j'etais preparatrice en pharmacie et j'ai repris mes etudes pour faire un BTS dietetique.
    je me bats pour comprendre la biochimie et vraiment je m'en sors mais là, je baisse un peu les bras. c'est vraiment dur..... du moins pour moi.
    je vais essayer de reprendre ce que tu viens de m'expliquer. merci encore

  9. Publicité

Sur le même thème :

Discussions similaires

  1. [Offre] Post-doc en biologie moléculaire et génétique
    Par Yoyo dans le forum Stages
    Réponses: 2
    Dernier message: 10/12/2007, 12h16
  2. [Génétique] génétique moléculaire
    Par GALAK02 dans le forum Biologie
    Réponses: 2
    Dernier message: 11/11/2007, 17h45
  3. Génétique moléculaire
    Par 'tite miss dans le forum Biologie
    Réponses: 4
    Dernier message: 25/05/2005, 19h01
  4. Réponses: 25
    Dernier message: 02/11/2004, 09h06
  5. [Biologie Moléculaire] [biologie moleculaire] Le code génétique
    Par Yoyo dans le forum Biologie
    Réponses: 28
    Dernier message: 08/01/2003, 17h04