Répondre à la discussion
Affichage des résultats 1 à 3 sur 3

ADN-ARNm



  1. #1
    ado
    Salut à tous!
    Je voudrais savoir pourquoi dit on que le brin transcrit d'ADN n'est pas codant tandis que le brin non transcrit est codant.
    Merci d'avance

    -----


  2. #2
    Yoyo
    Salut,

    quand on parle de brin codant on veut dire :"brin dont la sequence est identique a celle presente sur l'ARNm".

    Or si tu transcript ce brin "codant" eh bien tu te retrouves avec un ARNm dont la sequence sera l'inverse de celle que tu souhaites (a cause de la complementarite des bases). la transcription de l'ADN s'effectue toujours de 3' ->5'.

    5' ATCCGTCGAATGAAATTTCCCGGGTAAAGGGTCA 3'
    3' TAGGCAGCTTACTTTAAAGGGCCCATTTCCCAGT 5'

    Si ta sequence codante est : ATGAAATTTCCCGGGTAA (brin sup)
    alors le brin transcript sera le brin inferieur. Le brin sera lu de 3'->5' afin de permettre l'incorporation des ribonucloetides constituant l'ARNm de 5' en 3'.
    Le brin dit "codant" dans cet exemple est le brin superieur.

    Yoyo

  3. #3
    ado

    Wink Re : ADN-ARNm

    Citation Envoyé par Yoyo
    Salut,

    quand on parle de brin codant on veut dire :"brin dont la sequence est identique a celle presente sur l'ARNm".

    Or si tu transcript ce brin "codant" eh bien tu te retrouves avec un ARNm dont la sequence sera l'inverse de celle que tu souhaites (a cause de la complementarite des bases). la transcription de l'ADN s'effectue toujours de 3' ->5'.

    5' ATCCGTCGAATGAAATTTCCCGGGTAAAGGGTCA 3'
    3' TAGGCAGCTTACTTTAAAGGGCCCATTTCCCAGT 5'

    Si ta sequence codante est : ATGAAATTTCCCGGGTAA (brin sup)
    alors le brin transcript sera le brin inferieur. Le brin sera lu de 3'->5' afin de permettre l'incorporation des ribonucloetides constituant l'ARNm de 5' en 3'.
    Le brin dit "codant" dans cet exemple est le brin superieur.

    Yoyo

    Merci bien!

Sur le même thème :

Discussions similaires

  1. ADN ARNm
    Par maech dans le forum Biologie
    Réponses: 31
    Dernier message: 28/09/2007, 09h35
  2. ADN, ARNm, ARNt, polypeptyde
    Par Soo dans le forum Biologie
    Réponses: 0
    Dernier message: 28/05/2007, 18h41
  3. L1/ARNm
    Par lucieb dans le forum Biologie
    Réponses: 1
    Dernier message: 09/03/2007, 00h03
  4. Epissage ARNm
    Par canard dans le forum Biologie
    Réponses: 6
    Dernier message: 29/10/2006, 09h49
  5. ARNm
    Par zebbu dans le forum Biologie
    Réponses: 12
    Dernier message: 06/12/2005, 22h09