Répondre à la discussion
Affichage des résultats 1 à 12 sur 12

Identification d'un gène déterminé



  1. #1
    Pilis

    Identification d'un gène déterminé


    ------

    Salut à tous !

    Je vous préviens déjà que je suis en première donc pas un niveau de fou mais voici ma question :

    Disons que j'ai de bactéries. Bactéries 1 a une résistance aux antibiotiques des béta-lactamines encodé dans un plasmide. Ce gène bien connu est le gène bla.
    Maintenant j'ai une bactérie 2. Je veux savoir si cette bactérie a aussi cette résistance ci. Je veux le montrer à l'aide d'un PCR puis gèle éléctroporèse. Est-ce possible ? (j'imagine que oui, sinon comment faut-il faire ?)

    Comment dois-je m'y prendre ?

    j'imagine qu'il faut découpé ce gène dans la bactérie 1, à l'aide d'enzyme de restriction, puis dans le PCR ajoutez ajouté des: ddatp, ddttp, ddctp, ddgtp fluorescent afin de pouvoir avoir une séquence de ce gène contenue dans la bactérie 2, si la bactérie 2 à ce gène. Mais après il y'a la question des Primer. Je suis un peu perdu, pourriez-vous m'aider ?

    Merci de votre aide !

    -----

  2. Publicité
  3. #2
    Flyingbike

    Re : Identification d'un gène déterminé

    non
    si le gene est connu, on dessine des primes permettant d'en amplifier une partie dans la bactérie 1
    On fait une PCR sur l'ADN de la bactérie 2 (en contrôle positif on met l'ADN de la bactérie 1 bien sur)

    Si signal : le gène est la
    si pas de signal : il est pas la

    Notons que (je ne sais pas pour ce cas particulier) une bactérie peut etre résistante grâce a un autre mécanisme impliquant un autre gène. (donc si pas de signal, ca ne veut pas dire que la bactérie sera pas résistante)
    La vie trouve toujours un chemin

  4. #3
    Pilis

    Re : Identification d'un gène déterminé

    Oui je sais qu‘elle peut toute fois être résistante merci
    Et encore une question:
    Comment on dessine les primes ?

  5. #4
    Pilis

    Re : Identification d'un gène déterminé

    Salut
    Après des renseignements approfondie voici comment s‘y prendre :

    À l‘aide restriction Enzymen puis d‘un PCR on obtient un primer
    Sinon tu peux demander à une entreprise spécialisé de construire un primer d‘après les bases que tu leur imposes voilà

  6. #5
    Flyingbike

    Re : Identification d'un gène déterminé

    non on ne fait pas de primer avec des enzymes de restriction
    on les synthétise (ou fait synthétiser)
    La vie trouve toujours un chemin

  7. A voir en vidéo sur Futura
  8. #6
    Pilis

    Re : Identification d'un gène déterminé

    Salut,

    Si avec des enzymes de restrictions :

    séquence(en gras) ADN 1 : ATTTTTTCGCGCGTCGATCGATCGATTTAG

    On veut vérifier si cette séquence se trouve dans ADN 2 donc, il faut que cette séquence soit le primer de l'ADN 2 lors du PCR à l'aide d'enzyme de restriction on va découper ce qu'il y'a autour pour n'avoir que la séquence ( je ne sais pas si il existe des enzymes de restrictions qui peuvent découper cette suite, mais là ce n'est qu'un exemple)
    Et du coup on obtient : TCGCGCGTCGATCGATC et cette séquence pourra s'accrocher avec un sa même séquence dans l'adn 2 lors du PCR et si ce n'est pas le cas, à la fin du PCR il n'y aura rien.

    Non ?

    Merci d'avance (un troisième avis serait le bienvenu )

  9. Publicité
  10. #7
    Flyingbike

    Re : Identification d'un gène déterminé

    NON, on ne fait pas comme cela

    1-Parce qu'on n'a pas d'enzyme pour couper ça
    2-parce que les amorces sont par couple
    3-parce que les amorces sont des ADN simple brin
    4-parce que c'est totalement hasardeux
    5-parce que ca prend 3 jours et coute moins de 10€ de commander des amorces

    A la limite, on procédait à peu près de la sorte avec une vieille technique en voie de disparition, qui s'appelle le southern blot (pour simplifier très très largement)
    La vie trouve toujours un chemin

  11. #8
    Pilis

    Re : Identification d'un gène déterminé

    Haha ok, bon je me tais. Je ne vais pas commencer à te contredire

    En tout cas merci pour l'éclaircissement.

    Mais maintenant me viens une autre question :

    Quelles autres méthodes seraient envisageables pour vérifier si une séquence précise se trouve dans une ADN. Reprenons mon exemple plutôt, quelles méthodes existent-ils pour identifier le gène bla dans une ADN bactérienne (situé dans un plasmide ou dans son patrimoine génétique, peut importe) ?
    Dernière modification par Pilis ; 30/11/2017 à 19h52.

  12. #9
    Flyingbike

    Re : Identification d'un gène déterminé

    si on connait au minimum la séquence du gène, PCR, southern blot (old school)

    quel est le but ?
    La vie trouve toujours un chemin

  13. #10
    Pilis

    Re : Identification d'un gène déterminé

    Ok bon bah j'explique tout :

    J'ai une bactéries ayant un plasmide contenant une résistance aux béta-lactasame. Le gène de cette résistance est le gène bla. Je connais donc sa séquence. Et je voudrai vérifier sur des bactéries (E.coli U12 HB101) , porteuses de cette résistance, si ce gène peut être transporté/ incorporé du plasmide dans leur le patrimoine génétique. Donc si je reformule ma question je veux observer si une gène (en l'occurrence le gène bla ici) qui se trouve tout d'abord dans un plasmide peut être recopié par la bactérie dans son patrimoine génétique. Et est-ce possible que cela se produise ?
    Et si ce n'est pas le cas pour cette bactérie, en plus généralement existe-il des cas particuliers ou certains gènes d'un plasmide peuvent être recopier volontairement dans le patrimoine génétique d'une bactérie ?
    Merci de vos réponses !
    Dernière modification par Pilis ; 30/11/2017 à 21h07.

  14. #11
    Flyingbike

    Re : Identification d'un gène déterminé

    Citation Envoyé par Pilis Voir le message
    Ok bon bah j'explique tout :


    Et si ce n'est pas le cas pour cette bactérie, en plus généralement existe-il des cas particuliers ou certains gènes d'un plasmide peuvent être recopier volontairement dans le patrimoine génétique d'une bactérie ?
    Merci de vos réponses !
    oui c'est possible! par recombinaison par exemple, et c'est utilisé au laboratoire
    La vie trouve toujours un chemin

  15. #12
    Pilis

    Re : Identification d'un gène déterminé

    Ok

    La bactéries E.coli en est-elle capable ?

    une seule bactérie E.coli est-elle capable de chercher un gène dans son propre plasmide ou est-ce qu'une conjugaison bactérienne est obligé d'avoir lieu ?

    Et pourquoi est-ce utilisé au laboratoire ?

    Merci beaucoup !

  16. Publicité

Sur le même thème :

Discussions similaires

  1. Identification de protéine, gène
    Par Shirley6 dans le forum Exercices en biologie
    Réponses: 0
    Dernier message: 23/11/2015, 10h19
  2. [Biologie Moléculaire] identification gène PCR
    Par Alexa-Gyndom dans le forum Biologie
    Réponses: 1
    Dernier message: 03/03/2013, 15h29
  3. [Génétique] Qu'est-ce qui détermine le taux de mutation d'un gène?
    Par sophonax dans le forum Biologie
    Réponses: 4
    Dernier message: 29/12/2010, 08h06
  4. [Biologie Moléculaire] identification d'un gène
    Par nissabiol dans le forum Biologie
    Réponses: 26
    Dernier message: 03/10/2008, 00h32
  5. Actu - Un gène qui détermine la forme des tomates
    Par RSSBot dans le forum Commentez les actus, dossiers et définitions
    Réponses: 2
    Dernier message: 01/04/2008, 19h03