Répondre à la discussion
Affichage des résultats 1 à 5 sur 5

Le mystère d'une transgénèse



  1. #1
    insuloya

    Le mystère d'une transgénèse


    ------

    Bonjour, comment expliqueriez-vous le fait que les cellules de lapin dans lesquelles on a introduit des gènes de paramécie codant pour des protéines membranaires ne synthétisent pas ces protéines mais seulement des fragments ?

    En traduisant le brin transcrit d'ADN du gène en question (TATTTCTCCATGCCGCTCATTCGTGCACG A), je m'aperçois que le 7e codon de la protéine est le codon STOP, mais que dire de plus...

    Merci de votre aide

    -----

  2. #2
    Florian25

    Re : Le mystère d'une transgénèse

    s'est une question d'enzyme et de site de restriction

  3. #3
    Yoyo

    Re : Le mystère d'une transgénèse

    Salut

    On va pas resoudre ton exo a ta place
    qu'est-ce que tu peux imaginer comme raison? reflechi notamment a ta remarque sur le codon stop en 7eme position.

    PS/ la reponse de florian25 est fausse.

    YOyo

  4. #4
    Florian25

    Re : Le mystère d'une transgénèse

    s'était une idée comme les autre yoyo je men fiche royalement du lapin je m'intéresse cas l'homme

  5. A voir en vidéo sur Futura
  6. #5
    insuloya

    Re : Le mystère d'une transgénèse

    Citation Envoyé par Yoyo Voir le message
    Salut

    On va pas resoudre ton exo a ta place
    qu'est-ce que tu peux imaginer comme raison? reflechi notamment a ta remarque sur le codon stop en 7eme position.

    PS/ la reponse de florian25 est fausse.

    YOyo
    Il ne s'agit pas de "mon exo" Merci tout de même, YoYo

Discussions similaires

  1. dans un trou noir (mystere grand mystere!)
    Par clanki357 dans le forum Archives
    Réponses: 49
    Dernier message: 21/11/2007, 08h06
  2. transgenese
    Par selmich dans le forum Biologie
    Réponses: 1
    Dernier message: 16/05/2007, 00h36
  3. Transgénèse d'une bactérie
    Par faurival dans le forum Biologie
    Réponses: 1
    Dernier message: 07/01/2007, 13h33
  4. Transgenèse
    Par Stunt dans le forum Biologie
    Réponses: 4
    Dernier message: 24/06/2006, 12h54
  5. transgenèse
    Par jessy1334 dans le forum Biologie
    Réponses: 6
    Dernier message: 01/07/2005, 10h34
Découvrez nos comparatifs produits sur le sport et la santé : thermomètre médical, soins personnels...