Répondre à la discussion
Affichage des résultats 1 à 9 sur 9

EXON et concensus de Kozak



  1. #1
    Douviss

    Arrow EXON et concensus de Kozak

    Bonsoir tout le monde,

    j'ai quelque questions à vous poser car je ne trouve pas ldes reponses par moi même.

    tout d'abord pour Kozak si j'ai une sequence:

    CC(A/G)CCAUGG

    Je voulais savoir si les C sont variable ici si je peux avoir d'autre lettres ?

    pour la second question.

    Comment reconnait on le début et la fin d'un Exon ? Y A T il une séquence d'initiation ? de meme pour l'intron svp?...

    Merci d'avance

    -----


  2. Publicité
  3. #2
    Jean-Luc P

    Re : EXON et concensus de Kozak

    C'est uen séquence consensus, ce qui signifie que parfois ça marche même quand une base est différente.
    Ceci est la séquence idéale, muter une base peut la rendre non fonctionnelle, ou juste moins efficace.

    Pour exon/intron il faut identifier les signaux d'excision dans la séquence.. pas toujours facile. Cf les différentes classes d'introns.
    Jean-Luc
    La violence est le dernier refuge de l'incompétence.
    Salvor Hardin

  4. #3
    Douviss

    Re : EXON et concensus de Kozak

    Hum identifier les séquence d'excision des introns, j'ai rien dessus dans mon cours par contre j'ai chercher et j'ai trouver la chose suivante:

    quand une séquence commence par AUG il s'agit d'un début d'exon et elle setermine par UAA, UAG ou UGA est ce exacte ?

  5. #4
    sacharybalka

    Re : EXON et concensus de Kozak

    Salut!
    je crois que tu confonds la transcription et la traduction. AUG est la séquence qui débute la traduction, synthèse de protéine, et donne un acide aminé, méthionine.
    Par contre pour la transcription, synthèse de l'ARN, le début est provoqué par la fixation de facteur sigma sur un promoteur (pour les eucaryotes). Le facteur sigma recrute l'ARNpolymérase, qui débute la synthèse d'ARN. la terminaison se fait apparemment de deux manières : soit grâce à un facteur spécifique, rho, soit parce que l'ARN synthétisé adopte une structure secondaire particulière, en boucle, qui provoque la séparation du complexe. c'est loin d'être complet, va voir sur des sites des facs, tu trouveras plein d'infos ex http://www.chups.jussieu.fr/polys/bi...och/index.html
    ... y compris sur les exons
    ou encore http://www.univ-tours.fr/genet/fichi.../gen000600.htm
    voilà

  6. #5
    piwi

    Re : EXON et concensus de Kozak

    Non,
    AUG est un codon qui code pour la methionine. C'est toujours par ce codon que commence la traduction. Ca ne veut pas dire qu'on le retrouvera au début de chaque exon.
    De la même manière les autres codons sont des codons dits "stop" qui ne codent pour rien. Ils induisent donc un arrêt définitif de la traduction. Ca ne veut pas dire qu'on en retrouve à la fin de chaque exon.

    Pour l'epissage vous avez duex mécanismes:
    autocatalytique
    médié par les snRNP
    En simplifiant un peu on dira qu'il faut que l'y ait un G très conservé au début et à la fin de l'intron à exciser ainsi qu'un A dans la séquence.

    Les séquences ne sont pas simple à identifier mais on peut définir, en tout cas pour les excisions médiées par snRNP des séquences consensus:
    début de l'intron: (A/C)AG|GU(A/G)AGU
    fin de l'intron: (U/C)AG|G
    dans l'intron: (U/C)NCU(A/G)AC

    Voilà voilà.

    Cordialement,
    piwi

  7. A voir en vidéo sur Futura
  8. #6
    Douviss

    Re : EXON et concensus de Kozak

    Merci pour vos reponses,

    mais malheureusement je n'arrive toujour pas a répondre a mes questions...

    je ne confond pas traduction et transcription puisque AUG ne concerne que l'ARN (pas de U dans l'ADN).
    Sans rien cacher j'ai un exercice sur lequel je me suis penché depuis un certain temps on me demande de trouver le debut de chaque exon:
    Je vais en faire la copie exacte de la séquence proposée( Merci OCR )

    TTCCGCCCCTTTCTCTTCCAACTCCGCCTA CGCCCCAGAGAGGGAAGGCCTTGACACCTA CGCTAGAG AGACAGGCTCCAATGAAAAGAGCGAGGGGG CGGAGCCGGGAGGAATCGGTCCAATTCTCG GCCGGGAA GTCTCT/GGCCGGGACGGGGCAGGGCGAACCTGCCAG TGACTGGACTCAGCTTCTTTGCGTAACCAA T ACTGGAAGGCATTTAAAGGCACCTCTGCCG CCACAGACCTTGAGTTAACTCCGCCCTGAC CCACCCTT CGCGATGGAGTCCCTGATGCAGGCTCCCCT CCTGATCGCCCTGGGCTTGCTTCTCGCGGC CCCTGCGC AAGCCCACCTGAAAAAGGTGAGTGCACCCT CTTTTAAGAGTCTGTTTGCAGCCTCGTGGC CCAGCTAC GGGAATTATGGGATTCTGGTCTGTACAATG AGGGTGGCCTCTAAAGAAATGAGTAGGATA AGtGTTAT CCCAGCTTCATAGGTATGGAGTCTCATAGA TGAGGCTCAGGGACGGGGGTGCCTCACCCA AGGTCACT CTGCCAGGAGCTCATTTTTCCTGTGATCTG TGATAGTTTCTTTTGTCAACCTTTTTCTTC TTCTCCTT CCTTGCTGCCTGATTGTCCCCAGCCATCCC AGCTCAGTAGCTTTTCCTGGGATAACTGTG ATGAAGGG AAGGACCCTGCGGTGATCAGAAGCCTGACT CTGGAGCCTGACCCCATCATCGTTCCTGGA AATGTGAC CCTCAGTGTCATGGGCAGCACCAGTGTCCC CCTGAGTTCTCCTCTGAAGGTGAGCCTGGG GGTGGGTG GAGAACCCAGAGAATAGTACAGGACATGTA GATTCAGACACTCTTTCACAGGTTCATGGA ATCTCAGG ATCATAAGATTTCACACATGGGCCACAATG TTGCCATTCCTAGAACAGACTATCTCTAAG ATCTCATC CAGTTAAAAATTCTATGATTAAAATATATT GCTGCTTTTTTGAAGACAGAAGAGCTGGTA TGTTTGCC CTGGAATTTACACTTATAACCTTTTTCAAA CCTTTGTTTTATTTTTTTTTACCAGGTGGA TTTAGTTT TGGAGAAGGAGGTGGCTGGCCTCTGGATCA AGATCCCATGCACAGACTACATTGGCAGCT GTACCTTT GAACACTTCTGTGATGTGCTTGACATGTTA A

    et à partir de la je dois isoler les Exons....

    donc moi ce que je fais c'st chercher les seq ATG pour le debut de chaque exon et les seq codante stop... mais donc un codon qui code stop n'est pas forcément la fin d'un exon... et je suis perdu

  9. Publicité
  10. #7
    Douviss

    Re : EXON et concensus de Kozak

    pas d'indice ? ça doit être possible mais comment ?

  11. #8
    Yoyo

    Re : EXON et concensus de Kozak

    Bonsoir

    Le codon ATG est utilisé pour initier la traduction il est donc present au debut de la sequence codante, mais il n'est pas utile d'en avoir un a chaque exon!
    Pour identifier tes introns tu dois trouver les bornes d'epissages, ces sequences t'ont probablement été données dans ton cours.

    apres tu deletes tout ce qui est compris entre ces bornes et tu as ainsi tous tes exons!

    Yoyo

  12. #9
    Douviss

    Re : EXON et concensus de Kozak

    Re bonjour,

    J'ai fini par trouver j'ai pas fait l'analogie entre le DNA et le mRNA j'avais les du meme génome.... comme le mRNA ne contient pas d'introns il suffit de comparer les 2 chaines..... et les exons apparaissent par eux même, c'était très bête.
    Merci à vous
    C'est en cherchant et en demandant qu'on apprend!

Sur le même thème :

Discussions similaires

  1. [Génétique] Intron et exon
    Par Chrysander dans le forum Biologie
    Réponses: 32
    Dernier message: 02/05/2016, 22h11
  2. intron vs exon:
    Par hammer6 dans le forum Biologie
    Réponses: 6
    Dernier message: 08/02/2007, 16h03
  3. séquence kozak
    Par delstephie dans le forum Biologie
    Réponses: 1
    Dernier message: 06/02/2007, 12h40
  4. exon optionnel et site d'épissage interne
    Par gobronn dans le forum Biologie
    Réponses: 4
    Dernier message: 01/01/2007, 11h35
  5. exon / intron
    Par snowteam dans le forum Biologie
    Réponses: 13
    Dernier message: 11/01/2005, 14h37