Répondre à la discussion
Page 1 sur 2 1 DernièreDernière
Affichage des résultats 1 à 30 sur 33

Intron et exon




  1. #1
    Chrysander

    Intron et exon

    Bonjour à tous !

    J'aimerais bien savoir à quoi pourrait bien servir les introns et les exons? A quoi cela sert-il de les différencier? Tout simplement, pourquoi les introns existe t'ils? Merci

    -----

    L'Univers est assez grand pour que rien ne soit impossible

  2. Publicité
  3. #2
    secheuso
    Bonjour/soir!

    C'est bien tu me fais faire des révisions! J'ai sorti mes cours de première année de DEUG SV, ce n'est pas très fourni en ce qui concerne les introns et les exons mais bon ça peut déjà apporter un petit élément de réponse!

    D'après mes qq notions, un intron est la partie non codante d'un gène. L'exon est la partie codante de l'ADN au sein d’un gène.

    Ce sont les introns qui sont momentanément clivés lors de la transcription chez les eucaryotes (d'une manière c'est logique, vu qu'ils ne "codent" pas...)

    Il existe une hypothèse, l'hypothèse "exonshuffing" (en français: remaniement des exons) :les exons correspondraient à des domaines protéiques et l'épissage (c'est l'étape qui correspond au clivage des introns) favoriserait de nouvelles combinaisons de domaines et ainsi permettrait une évolution.

    Voilà pour qq infos un peu en vrac! J'espère que qq d'autre pourra t'apporter une réponse un peu plus précise!

    S.

  4. #3
    Chrysander
    Salut à toi secheuso

    Le fait qu'ils servent pour les mutations explique t'il vraiment tout? Au fait, comment la cellule sait quelles parties sont des exons et lesquelels sont des introns? merci

    Au fait, bienvenue !
    L'Univers est assez grand pour que rien ne soit impossible


  5. #4
    Yoyo
    Bonsoir,

    Bon je vais essayez de repondre dans l'ordre aux questions

    - Les introns servent donc a differencier les ARNm matures des ARNm non matures.
    Le role des introns est encore discutable, ils peuvent (ou ont pu) jouer un role evolutif. Ils peuvent occasionellement coder pour des proteines, ou des ARN non codant qui vont alors jouer un role dans la regulation de la stabilite des ARNm.
    Ensuite grace a l'epissage alternatif (possibilite de ne pas exciser tous les introns) on obtiens a partir d'un seul gene, plusieurs ARNm, donc plusieurs proteines.... interessant non?

    Comment la cellule reconnait les introns?
    Il y a un gros complexe constitué de proteines et d'ARN nommé le spliceosome qui intervient dans l'excision des introns. Ceux ci sont reconnus car a chacunes des jonctions intron/exon il existe des sequences nucleotidiques particulieres reconnues par ce complexe et qui permettent l'epissage.
    pour illustrer mon propos :
    <a href="http://www.cu.lu/labext/rcms/cppe/traducti/tjpeg/epis2.jpeg" target="_blank">
    Cliquez ici pour agrandir l'image</a>

    Certaine classe d'intron sont cependant capable de s'exciser seuls, (auto-catalytiques). Prouvant que l'ARN peut avoir une activite de lui meme.

    Voila c'est tres condense, et probablement partiel

    Yoyo

  6. #5
    Chrysander
    Citation Envoyé par Yoyo
    Les introns servent donc a differencier les ARNm matures des ARNm non matures
    Je ne suis pas sur de comprendre ce que veux dire "ARNm mature". Ce serait un ARNm entier et conforme à la séquence de l'ADN transcrite?

    Citation Envoyé par Yoyo
    Ensuite grace a l'epissage alternatif (possibilite de ne pas exciser tous les introns) on obtiens a partir d'un seul gene, plusieurs ARNm, donc plusieurs proteines.... interessant non?
    Je sais, je pose beaucoup de question, mais, comment peut-on ne pas exciser tout les introns? Comment la cellule sais quel intron elle doit exciser pour tel gène et tel autre qui faut conserver?
    Merci
    L'Univers est assez grand pour que rien ne soit impossible

  7. A voir en vidéo sur Futura
  8. #6
    kinette
    Bonjour,
    Je ne suis pas sur de comprendre ce que veux dire "ARNm mature". Ce serait un ARNm entier et conforme à la séquence de l'ADN transcrite?
    Non en fait c'est l'inverse, un ARNm mature est l'ARNm après épissage (près à être traduit).

    Quand à leur rôle...
    Il me semble que dans certains cas on peut avoir des séquences régulant la transcription du gène dans les introns (?).

    En recherchant de la doc sur les introns je suis tombée sur ceci:
    I.3.4.5. Rôle des introns

    Rappelons qu’ils ont été découverts chez les eucaryotes supérieurs. Certains procaryotes possèdent des introns dans leurs gènes (archébactéries). Le rôle des introns est encore discuté. Cependant, quelques idées semblent émerger. Les introns pourraient faciliter l’élaboration de gènes complexes en délimitant des séquences codantes et permettant ainsi la mobilité des exons dans le génome. Enfin, l’absence d’introns dans un génome bactérien pourrait signifier que la bactérie est parvenue au stade ultime de son évolution et qu’elle aurait perdu toute possibilité d’évoluer vers la complexité.
    http://cri-cirs-wnts.univ-lyon1.fr/P...laire-9.html#I
    Sur ce site qui a l'air de bien détailler les mécanismes!
    http://cri-cirs-wnts.univ-lyon1.fr/P...-Sommaire.html

    (en remontant dans l'arborescence on trouve pas mal de choses susceptible d'intéresser des étudiants en premier biologie et médecine: http://cri-cirs-wnts.univ-lyon1.fr/P...ies/index.html)

    K.
    Nomina si nescis, perit et cognito rerum.

  9. #7
    John78
    I.3.4.5. Rôle des introns

    Rappelons qu’ils ont été découverts chez les eucaryotes supérieurs. Certains procaryotes possèdent des introns dans leurs gènes (archébactéries). Le rôle des introns est encore discuté. Cependant, quelques idées semblent émerger. Les introns pourraient faciliter l’élaboration de gènes complexes en délimitant des séquences codantes et permettant ainsi la mobilité des exons dans le génome. Enfin, l’absence d’introns dans un génome bactérien pourrait signifier que la bactérie est parvenue au stade ultime de son évolution et qu’elle aurait perdu toute possibilité d’évoluer vers la complexité.

    Cette explication évolutive des introns n'a strictement aucun sens. D'une part il existe des introns dans des génomes bactériens et d'eucaryote sois-disant inférieur, appartenant à des phyla très divergent.

    Ensuite les génomes bactériens continuent d'évoluer avec ou sans intron, il n'y a pas de stade ultime, d'arret ou je ne sais quoi.

    Enfin chez les Eucaryotes, un intron peut etre perdus ou gagné, on connait même des cas de perte presque totale d'introns chez certain génome de protiste (Euc. unicellulaire) endosymbiote d'autre Eucaryote (ex: le nucléomorphe de Guillardia theta). Ces organismes ont des tout petits génomes, réduit à l'extrème, avec peu ou pas d'intron et des séquences intergénique très courte.

    Il n'y a strictement aucune direction dans l'évolution, a fortiori au niveau des gains (ou des pertes) d'introns !

    A+
    John

  10. Publicité
  11. #8
    kinette
    Merci John pour ces précisions
    (moi aussi ça me paraissait bizarre cette histoire d'"évolution ultime ).

    Par contre pour le côté mécanistique le site semble pas mal.

    K.
    Nomina si nescis, perit et cognito rerum.

  12. #9
    Chrysander
    Merci à tous pour ces précisions !

    On sais que un gène peu coder pour plusieurs protéines. Mais, je crois avoir lu quelque part qu'une proteine peut avoir ca séquence qui est codé sur différents locus (locus ou loci? j'ai jamais su). Ce pourait-il donc que ces introns marque le début d'une partie d'une proteine et que une autre partie se trouverais à un autre endroit? Ce serait prendre une partie qui nous interesse de la proteine "normale" (cad celle qui devait à la base être codée par le gène entier où se situe l'intron) et une autre sur une autre molécule?
    L'Univers est assez grand pour que rien ne soit impossible

  13. #10
    John78
    Citation Envoyé par Chrysander
    Ce pourait-il donc que ces introns marque le début d'une partie d'une proteine et que une autre partie se trouverais à un autre endroit? Ce serait prendre une partie qui nous interesse de la proteine "normale" (cad celle qui devait à la base être codée par le gène entier où se situe l'intron) et une autre sur une autre molécule?

    Ca peut marcher comme ça, mais les introns n'ont pas grand chose à voir la dedans ! On sait qu'au cours de l'évolution un gène codant pour une protéine peut etre scinder en deux ou en trois génes physiquement séparés dans le génome, la protéine n'étant fonctionelle qu'avec les deux ou trois sous-unités réunies (ou non d'ailleurs !). Et inversément, certaines enzymes se sont formé au cours de l'évolution par fusion de 2 ou plusieurs "modules".
    Shématiquement ca peut se concevoir comme un jeu de Légo, l'évolution bricolant avec ce qu'elle a sous la main.

    Peut etre que tu confonds avec le processus d'épissage alternatif qui fait qu'un même gène peut coder pour plusieur protéines par réassortiment des différents exons entre eux ???

    A+
    John

  14. #11
    Yoyo
    Ce que dit chrysander se raproche fortement de ce que l'on appel le transepissage.
    C'est a dire en effet la capacite d'effectuer un epissage sur deux molecules d'ARN differentes, afin de n'aboutir qu'a une seule molecule.
    Cela a notament ete montre chez C. elegans.

    Moi j'adore tous ces mecanismes qui sortent de l'ordinaire

    Yoyo

  15. #12
    Chrysander
    Citation Envoyé par John78
    Peut etre que tu confonds avec le processus d'épissage alternatif qui fait qu'un même gène peut coder pour plusieur protéines par réassortiment des différents exons entre eux ???
    Heu... non. En fait, c'est une idée que j'ai émise, et qui me semble pas si bête. Imaginons deux proteines ayant certaines de leurs partie similaires et issues de gènes A et B différents. Pourquoi coder plusieurs fois pour la même partie? Il suffirait pour le gène A, par exemple, de faire référence à une séquence contenue sur le gène B au lieu d'avoir la même séquence. Il se peut que c'est une idée tout à fait farfelue, mais, je trouve que la génétique se rapproche beaucoup de la programmation, et en programmation, on utilise beaucoup ce genre de méthode.
    L'Univers est assez grand pour que rien ne soit impossible

  16. #13
    Tarc
    Citation Envoyé par Chrysander
    Imaginons deux proteines ayant certaines de leurs partie similaires et issues de gènes A et B différents. Pourquoi coder plusieurs fois pour la même partie? Il suffirait pour le gène A, par exemple, de faire référence à une séquence contenue sur le gène B au lieu d'avoir la même séquence. Il se peut que c'est une idée tout à fait farfelue, mais, je trouve que la génétique se rapproche beaucoup de la programmation, et en programmation, on utilise beaucoup ce genre de méthode.
    Sauf qu'en programmation, il y a un programmeur qui cherche à éviter le gaspillage de mémoire. Quand de nombreuses protéines de la même famille ont de longues séquences communes, eh bien les gènes qui codent pour elles ont eux aussi de longues séquences communes, voilà tout. C'est du gaspillage d'espace, c'est sûr, mais les gènes évoluent souvent par duplications complètes de gènes préexistants qui se font au hasard (et ne se révèlent avantageuses que quand une des copies parvient à diverger suffisamment pour assurer une fonction nouvelle). Dans ce contexte, il est difficile d'imaginer la mise en place d'un mécanisme du genre "bon, pour les acides aminés 25 à 52, se reporter à l'article 2 du gène 37, alinéa 3".

  17. #14
    Tarc
    Il me semble d'ailleurs qu'il existe, dans tous les génomes (enfin, au moins dans certains, ça j'en suis sûr), des gènes existant en plusieurs copies différentes - toutes strictement identiques et issues de duplications.

    Donc, ce qui se passe souvent avec les gènes qui se ressemblent codant pour des protéines qui se ressemblent elles aussi, c'est qu'il y a une duplication, qu'on a pendant un certain temps deux gènes totalement identiques et que les deux copies divergent par la suite. On peut observer tous les stades de cette évolution dans la nature. Difficile de caser un mécanisme qui n'utiliserait qu'une seule séquence de nucléotides pour coder plusieurs séquences d'acides aminés dans des protéines différentes... En revanche, l'épissage alternatif (où certains triplets sont alternativement introns et exons pour permettre une plus grande diversité des protéines) a bien l'air d'exister.

  18. #15
    kinette
    Bonjour,

    Quand de nombreuses protéines de la même famille ont de longues séquences communes, eh bien les gènes qui codent pour elles ont eux aussi de longues séquences communes, voilà tout. C'est du gaspillage d'espace, c'est sûr, mais les gènes évoluent souvent par duplications complètes de gènes préexistants qui se font au hasard (et ne se révèlent avantageuses que quand une des copies parvient à diverger suffisamment pour assurer une fonction nouvelle). Dans ce contexte, il est difficile d'imaginer la mise en place d'un mécanisme du genre "bon, pour les acides aminés 25 à 52, se reporter à l'article 2 du gène 37, alinéa 3".
    Effectivement je ne connais pas de tels mécanisme pour les protéines... mais bon on ne sait jamais...
    On peut rapprocher ceci des enzymes qui possèdent plusieurs sous-unités (dont certaines peuvent être communes à plusieurs enzymes)... mais l'assemblage des sous-unité se fait après traduction...

    Il me semble d'ailleurs qu'il existe, dans tous les génomes (enfin, au moins dans certains, ça j'en suis sûr), des gènes existant en plusieurs copies différentes - toutes strictement identiques et issues de duplications
    Effectivement les duplications sont monnaie courante... bon après les gènes dupliqués ne sont pas souvent "strictement identiques" à cause des mutations qui ne manquent pas d'apparaître...
    Il arrive aussi il me semble assez souvent qu'on ait des duplications, mais que certains gènes perdent leur promoteurs (du coup on se retrouve avec des "gènes" qui ne sont plus traduits, qui sont des répliques des gènes fonctionnels).

    Donc, ce qui se passe souvent avec les gènes qui se ressemblent codant pour des protéines qui se ressemblent elles aussi, c'est qu'il y a une duplication, qu'on a pendant un certain temps deux gènes totalement identiques et que les deux copies divergent par la suite. On peut observer tous les stades de cette évolution dans la nature. Difficile de caser un mécanisme qui n'utiliserait qu'une seule séquence de nucléotides pour coder plusieurs séquences d'acides aminés dans des protéines différentes...
    Exactement...
    Un très bel exemple de famille de gènes tous issus d'un même gène originel est l'ensemble des gènes codants pour l'hémoglobines (ce qui est joli est qu'on a des hémoglobines ayant des affinités pour l'oxygène différentes, et leur expression ne va pas être la même au cours du développement chez les mammifères: les foetus sont pourvus d'une hémoglobine ayant une affinité supérieure pour l'oxygène par rapport à celle de leur mère, ce qui facilite les échange entre mère et foetus).

    En revanche, l'épissage alternatif (où certains triplets sont alternativement introns et exons pour permettre une plus grande diversité des protéines) a bien l'air d'exister
    Oui ...
    D'ailleurs il est intéressant de noter que des "êtres vivants" (si on peut les considérer comme vivant cf. pas mal de discussions...) chez qui on a beaucoup trouvé d'épissage alternatif sont les virus (or ce sont les organismes certainement les plus limités en ce qui concerne la quantité de matériel génétique, qui doit souvent tenir dans des capsides de petite taille, et qui doit être traduit le plus rapidement possible afin d'avoir un taux de réplication maximal).

    K.apside
    Nomina si nescis, perit et cognito rerum.

  19. #16
    Chrysander
    Merci à tous pour ces précisions ! Mais, je me pose une nouvelle question. L'épissage alternatif, si j'ai bien compris, c'est quand un exon est traduit ou non. Ce qui donne plusieurs proteines différentes. Ce qui expliquerais pourquoi on a plus de proteines que de gène. Mais, on a 30 000 gène pour 1 millions de proteines ! Ce qui fait en moyenne 33 proteines par gène. N'est-ce pas un nombre un peu grand?
    L'Univers est assez grand pour que rien ne soit impossible

  20. #17
    kinette
    Mais, on a 30 000 gène pour 1 millions de proteines !


    Es-tu sûr de ces chiffres?
    K.i reste perplexe...
    Nomina si nescis, perit et cognito rerum.

  21. #18
    Chrysander
    Ben, c'est ce que j'ai apprit il y a quelques jours en amphi (biophysique puis de génétique).
    L'Univers est assez grand pour que rien ne soit impossible

  22. #19
    Yoyo
    Pour le nombre de gene il oscille entre 30000 et 60000, selon les estimations et les techniques utilisees. Mais il semble que le nombre soit cependant plus proche de 30 que de 60 (en l'etat actuel de nos connaissances! -on peut encore avoir des surprises!-)

    Pour les proteines, je crois que le proteome est en effet estime a environ un million. Mais encore une fois ca n'est qu'une estimation.

    Parmi les mecanismes pouvant rendre compte de telles differences on a :
    - epissage alternatif.
    - editing
    - differents sites d'initiation de la transcription
    - le recodage
    - les maturations proteolitiques
    etc...

    Yoyo

  23. #20
    Chrysander
    C'est quoi le editing et le recodage? Je ne connais pas ces mécanismes, mais, si je me trompe, il touche les gènes et non une partie "non-gène" de l'ADN. Mais, dans ce cas, ca fait quand même un facteur de 30 proteines par gène ! La moindre mutation sur ce gène pourrait avoir de grande conséquence non?
    L'Univers est assez grand pour que rien ne soit impossible

  24. #21
    kinette
    Parmi les mecanismes pouvant rendre compte de telles differences on a :
    - epissage alternatif.
    - editing
    - differents sites d'initiation de la transcription
    - le recodage
    - les maturations proteolitiques
    etc...
    Dans les mécanismes, il n'y a pas aussi le fait que certaines protéines ont plusieurs sous-unités? (du coup à partir de différentes sous-unités on peut avoir des combinaisons protéiques plus nombreuses...).

    K.
    Nomina si nescis, perit et cognito rerum.

  25. #22
    Yoyo
    - l'editing est le fait que des nucleotides (souvent des U) sont rajoutes a l'ARN apres sa synthese.
    par expl: AUGCCUUGACCCGAACCGG
    Apres editing: AUGUUCUCUUUUGACUCUCUGUAUAUUCCG G
    (j'ai rajoute les U au hasard et ce n'est pas le cas, l'insertion des nucleotides supplementaire se fait de maniere tres precise)

    L'aspect interessant dans ce cas la est que l'ARNm mature ne correspond pas a la sequence du gene!

    -Le recodage a lieu au niveau de la traduction de la l'ARNm par le ribosome. Il s'agit d'une lecture non conventionelle du code genetique.
    Par exemple le ribosome va changer de phase de lecture, ou ne pas reconnaitre un codon stop et continuer a traduire apres etc...

    Yoyo[/b]

  26. #23
    Yoyo
    Citation Envoyé par kinette
    Dans les mécanismes, il n'y a pas aussi le fait que certaines protéines ont plusieurs sous-unités? (du coup à partir de différentes sous-unités on peut avoir des combinaisons protéiques plus nombreuses...).

    K.
    Non je crois pas car generalement la taille du proteome est extrapolee a partir de gels 2D. Or ces gels sont denaturant donc en fait on voit des polypeptides.
    D'ailleurs ca me fait penser qu'il serait plus juste de parler de polypeptides plutot que de proteines, car comme le fait remarquer kinette plusieurs polypeptides peuvent ne donner qu'une seule proteine.

    Yoyo

  27. #24
    Chrysander
    Citation Envoyé par Yoyo
    j'ai rajoute les U au hasard et ce n'est pas le cas, l'insertion des nucleotides supplementaire se fait de maniere tres precise
    Oui, mais, qu'est-ce qui va dire à la cellule ou rajouter les U? A moins qu'il s'agisse d'un processus "en série". Cad que chaque fois que la cellule recevra un signal pour l'éditing, elle va ajouter les U à tel endroit ou tel autre en fonction de la séquence de l'ARNm. Par exemple, après 3 A et 2 C, elle rajoute un U. Est-ce un truc comme ca?
    L'Univers est assez grand pour que rien ne soit impossible

  28. #25
    Yoyo
    Salut,

    non c'est plus complexe que ca en plus il existe differents type d'editing, l'ajout de U, mais aussi le changement du A en I par exemple.
    tout ca est tres bien explique ici :
    editing

    la page te demande un password java, tu cliques sur ok deux fois, et la page s'affichera qd meme


    Yoyo

  29. #26
    kinette
    Bonjour,
    Je vois que l'editing est important chez le trypanosome... ça a quelque chose à voir avec le "camouflage antigénique" que pratique la bestiole? (si mes souvenirs sont bons les protéines de surface du parasite changent au cours du temps, rendant ainsi inefficace la réaction immunitaire dirigée contre elles).

    K.amouflage
    Nomina si nescis, perit et cognito rerum.

  30. #27
    John78
    Ciao

    Citation Envoyé par kinette
    Bonjour,
    Je vois que l'editing est important chez le trypanosome... ça a quelque chose à voir avec le "camouflage antigénique" que pratique la bestiole? (si mes souvenirs sont bons les protéines de surface du parasite changent au cours du temps, rendant ainsi inefficace la réaction immunitaire dirigée contre elles).

    K.amouflage

    Chez les kinetoplastide comme Trypanosoma, les mitochondries sont contenue dans une structure cellulaire particulière en forme de disque tout a fait originale : les kinetoplastes. L'ADN mitochondrial (issus d'une bactérie, rappel) des kinetoplastes a une structure circulaire particulière sous 2 formes : un maxicercle et un minicercle. Se sont les transcrits du maxicercle codant pour la chaine oxydatoire ou les ARNr qui sont fortement edité. A ma connaissance, le maxicercle ne code pas pour les facteurs de la résistance immunitaire évoqué. A ma connaissance toujours, les transcrits nucléaires des kinétoplastides ne sont pas édités (à vérifier).

    A+
    John

  31. #28
    Chrysander
    Citation Envoyé par Tarc
    Quand de nombreuses protéines de la même famille ont de longues séquences communes, eh bien les gènes qui codent pour elles ont eux aussi de longues séquences communes, voilà tout. C'est du gaspillage d'espace, c'est sûr, mais les gènes évoluent souvent par duplications complètes de gènes préexistants qui se font au hasard (et ne se révèlent avantageuses que quand une des copies parvient à diverger suffisamment pour assurer une fonction nouvelle).
    Pourtant, l'épissage alternatif n'est-il pas lui même un moyen d'économiser de la place?

    Citation Envoyé par Tarc
    Dans ce contexte, il est difficile d'imaginer la mise en place d'un mécanisme du genre "bon, pour les acides aminés 25 à 52, se reporter à l'article 2 du gène 37, alinéa 3".
    C'est pourtant quelque chose comme ca qui se passe dans l'épissage alternatif... même si c'est des séquence au lieu d'article


    En fait, l'épissage alternatif ressemble à ce que je disais : on sélectionne certaines partie qui nous interesse pour former une proteine donnée. Sauf que les parties se situent au niveau d'un seul gène.

    Je viens d'étudier l'épissage alternatif en cour et j'ai une question évolutionnaire. Comme on l'a déja souligné, la nature n'a pas hésité à recopier des gènes entiers dans d'autres parties du génome, ce qui donne la même proteine au final (au mutations près). L'épissage alternatif quand à lui utilise une même séquence mais de facon différentes à chaques fois. Ce qui fait que certain gènes codent pour 64 proteines différentes !! Pour moi, ca veut dire qu'une mutation sur un intron au niveau du début ou de la fin de l'intron (comme dans le cas de la béta-thalassémie) peut avoir des conséquence désastreuse (cf la maladie que je viens de citer), et pas seulement sur une proteine, mais, sur les 64 proteines différents, puisque c'est le début (et la fin) de l'intron qui permet de différencier les introns des exons... Pourquoi utiliser un système si dangereux plutot que de simplement "recopier" les différentes séquences pour les proteines ailleurs? Sans compter que c'est pas très pratique pour faire évoluer une espèce... En gros, pourquoi l'épissage alternatif existe t'il?

    Chrysander
    L'Univers est assez grand pour que rien ne soit impossible

  32. #29
    Lily52

    Re : Intron et exon

    Bonjour,

    Le fait que les introns soient aussi nombreux (par rapport aux exons) permet la protection de l'information génétique, ainsi que la prévention des mutations qui pourraient être délétères (ou non !)
    Si on a une SNP par ex il y a plus de chance que cela tombe sur un exon ! Et même si cela tombe sur un intron, avec la redondance du code génétique cela peut passer !

    Li2

  33. #30
    Flyingbike

    Re : Intron et exon

    Joli déterrage de 13 ans !!!
    Dommage que ce soit pour dire une bêtise
    La vie trouve toujours un chemin

Page 1 sur 2 1 DernièreDernière

Discussions similaires

  1. epissage intron du groupe II
    Par GALAK02 dans le forum TPE / TIPE et autres travaux
    Réponses: 0
    Dernier message: 03/02/2008, 11h43
  2. EXON et concensus de Kozak
    Par Douviss dans le forum Biologie
    Réponses: 8
    Dernier message: 18/02/2007, 09h56
  3. intron vs exon:
    Par hammer6 dans le forum Biologie
    Réponses: 6
    Dernier message: 08/02/2007, 16h03
  4. Polymorphisme d'un intron
    Par Mystery_Girl dans le forum Biologie
    Réponses: 2
    Dernier message: 26/06/2006, 10h38
  5. exon / intron
    Par snowteam dans le forum Biologie
    Réponses: 13
    Dernier message: 11/01/2005, 14h37