Répondre à la discussion
Affichage des résultats 1 à 25 sur 25

Programme de clonage



  1. #1
    Shell

    Programme de clonage

    Bonjour à toutes et tous,

    Voila je cherche un programme me permettant de faire des constructions de plasmide gratuit. Je connais GCK mais il n'est pas libre. Je sais qu'il existe également pDRAW et Serial cloner. J'aimerais vos avis et vos opinions sur ces petites programmes ou d'autres afin de choisir le meilleur.
    Merci à tous. Bone journée

    -----


  2. Publicité
  3. #2
    jmbowie

    Re : Programme de clonage

    Citation Envoyé par Shell Voir le message
    Bonjour à toutes et tous,

    Voila je cherche un programme me permettant de faire des constructions de plasmide gratuit. Je connais GCK mais il n'est pas libre. Je sais qu'il existe également pDRAW et Serial cloner. J'aimerais vos avis et vos opinions sur ces petites programmes ou d'autres afin de choisir le meilleur.
    Merci à tous. Bone journée
    Souhaitez vous dessiner des vecteurs ou bien les construire en manipulant des séquences ?
    Je conseille DNA Strider pour Mac, ou l'équivalent DNA Club sur PC
    Blast up your life!

  4. #3
    Shell

    Re : Programme de clonage

    Et bien en fait je compte construire des vecteurs à partir de vecteur pré-existant en ajoutant les séquences d'interêt.
    Je connais pas DNA Club, je vais aller voir ce que cela donne.
    Merci de la réponse
    Je ne suis pas difficile, je me satisfais aisément du meilleur. (Winston Churchill)

  5. #4
    fxmulder

    Re : Programme de clonage

    Salut,

    J'utilise Serial Cloner sur Mac, et ce logiciel est vraiment génial. C'est grace à lui que je teste mes clonages avant de les réaliser.
    Par exemple, tu veux faire un cloner une séquence que tu vas amplifier par PCR avec des sites de restrictions dans les primers pour l'insérer dans le vecteur cible :
    - Premièrement, il te fait la PCR à partir de tes amorces et de ton plasmide source.
    - Deuxièmement, lui demande de construire ton plasmide : Tu lui donnes ta PCR avec les deux sites de restriction, et de l'autre ton plasmide cible avec tes deux sites. Et tu récupère la séquence totale de ton nouveau plasmide. Je ne m'embette plus à faire ça sur papier et à vérifier 20 fois si j'ai fais une erreur de phase ou autre en tapant mes séquences vu que tout est déja sur le mac...

    D'après ce que j'ai vu, il y a d'autres fonctions sympas : Une digestion automatique (ton plasmide + une ou plusieurs enzymes) et il te donne le profil sur gel. Les fonctions de bases de DNA strider. Si je dis pas de bétises tu peux faire du Gateway et même du shRNA...

    Le seul petit point négatif, c'est le manque d'outil pour tout ce qui est protéines... Mais DNA Strider fait ça très bien.

  6. #5
    Shell

    Re : Programme de clonage

    Bonjour,
    Effectivement pas mal ce programme. Le seul hic, je n'arrive pas délimiter les gène d'interet sur le plasmide!!!!
    Merci de votre aide.
    Je ne suis pas difficile, je me satisfais aisément du meilleur. (Winston Churchill)

  7. A voir en vidéo sur Futura
  8. #6
    serialbasics

    Re : Programme de clonage

    Merci Shell et fxmulder pour ces commentaires sympas.
    Je suis le développeur de Serial Cloner et je travaille en effet sur l'implémenation des "features" sur les cartes pour enfin voir où sont nos inserts. J'espère bientôt.

  9. Publicité
  10. #7
    titebouille123

    Re : Programme de clonage

    Bonjour,

    Je souhaite insérer ma séquence d'interet (avec sites de restriction) dans un vecteur.
    J'ai téléchargé serial cloner mais je n'arrive pas à trouver comment procéder.

    Apparemment il faut choisir s il s'agit d'un vecteur type "ENTRY" ou "DEST" et plusieurs autres choses ...
    Mon vecteur est un pET21a+ mais je ne sais pas de quel type de vecteur il s'agit, ni si finalement il est nécessaire de le savoir...

    Si quelqu'un pouvait m'expliquer en gros les étapes à réaliser, celà pourrait bien m'aider ! )

    Je vous remercie !

    Charlotte.

  11. #8
    serialbasics

    Re : Programme de clonage

    Bonjour,

    Le module où il faut choisir les vecteur ENTRY/DEST est destiné aux vecteurs de type Gateway (Invitrogen). Ce n'est pas le cas des pET. Pour les vecteurs "classiques", il faut utiliser le menu "Build a Construct..." (ou cliquer sur 'construct' dans la barre d'icônes). Dans cette fenêtre de construction, il faut ouvrir la séquence du vecteur, choisir les sites de début (simple clic) et de fin (double clic). Faire de même avec l'insert. Blunter si nécessaire et cliquer sur "Ligate". Notez que si l'insert est, par exemple, EcoRI (début)/BamHI (fin) alors le vecteur doit être ouvert par BamHI (début) / EcoRI (fin).
    j'espère que c'est plus clair ainsi.

  12. #9
    titebouille123

    Re : Programme de clonage

    Merci beaucoup !

    Là je vois mieux comment procéder.
    Mais du coup il faut que je mette mon vecteur déjà digéré par mes enzymes de restriction.
    En fait je me demandais si avec ce logiciel on pouvait directement mettre le vecteur circulaire (séquence), spécifier avec quelles enzymes on veut couper, et qu'il nous donne la séquence du vecteur linéaire déjà découpée. Ou sinon pas grave je le ferai à la main !

    Merci encore

    charlotte.

  13. #10
    serialbasics

    Re : Programme de clonage

    Oui, Serial Cloner a été développé pour ça. Pour reproduire "in silico" ce que nous faisons à la paillasse. J'ai attaché un petit film (que j'avais fait pour un collègue) qui montre comment sous-cloner avec Serial Cloner. J'espère que ça répondra à vos questions.
    Fichiers attachés Fichiers attachés

  14. #11
    titebouille123

    Re : Programme de clonage

    Merci,

    Je pense que je vais arriver à me débrouiller avec toutes ces informations !

    Bonne journée !

  15. #12
    piwi

    Re : Programme de clonage

    Bonjour.
    Au nom de la modération je remercie serialbasics de prendre le temps d'aider les participants de cette discussion. Il y a quelque chose de merveilleux à parler d'un programme et de voir son développeur apparaitre grâce à la magie d'internet. J'espère que chacun mesure bien cette chance.

    Cordialement,
    piwi
    Je sers la science et c'est ma joie.... Il parait.

  16. Publicité
  17. #13
    titebouille123

    Re : Programme de clonage

    Re bonjour !

    Je suis désolée mais j'ai un peu de mal ...

    J'ai essayé de cloner ma séquence dans le vecteur Pet.
    Le problème est que je possède la séquence du vecteur mais je n'arrive pas à l'enregistrer sous forme circulaire.
    Du coup le programme utilise le vecteur de façon linéaire.
    J ai vu que lorsque l'on enregistre une séquence on a des options pour entrer les extrémités cohésives, est ce champ là qu'il faut remplir pour obtenir le vecteur sous forme circulaire ? Auquel cas je n'y suis pas arrivée.

    Si jamais vous avez la réponse à cette question je vous remercie d'avance !

    Charlotte.

  18. #14
    serialbasics

    Re : Programme de clonage

    Bonjour Charlotte,
    désolé, je n'avais pas vu cette nouvelle question.
    Il y a deux façons pour rendre une séquence circulaire : soit dans le menu "Sequence"- "Circularize" ; soit en utilisant un menu contextuel (clic-droit ou ctrl-clic) en cliquant sur le mot "linear" de la fenêtre contenant la sequence. Idem pour passer de circulaire à linéaire le cas échéant.

    Il ya en fait une autre façon qui est d'utiliser le menu "Sequence-Circularize" ou un menu contextuel lors de l'utilisation de la carte graphique (donc valable pour "Graphic Map" ou "Build a Construct").

    Si vous sauvez ensuite la séquence, la topologie sera sauvée.


    Le mode basé sur la carte graphique permet aussi de changer la topologie (sans sauver) afin de réaliser un clonage ("Build a Construct") en circularisant un plasmide que l'on aurait par erreur laissé sous forme linéaire.

    Désolé de n'avoir toujours pas eu le temps d'écrire un manuel plus complet...

    PS : merci Piwi pour le commentaire. Mais c'est un réel plaisir que de voir les gens utiliser pleinement un soft que l'on développé. Et ce contact direct développeur/utilisateur est en effet "magique".

  19. #15
    lumioguninca

    Re : Programme de clonage

    Bonjour

    J'utilise serial cloner (merci serialbasics) mais je ne trouve pas comment changer les couleurs des séquences soit les lettres ou surlignage dans la partie séquence soit les "flèches" sur le vecteur circulaire dans "graph map". Par contre j'ai trouvé dans "features" les couleurs pour les annotations des "features" dans grap map.
    Au secours "serialbasics" et meilleurs voeux

  20. #16
    serialbasics

    Re : Programme de clonage

    Citation Envoyé par lumioguninca Voir le message
    Bonjour

    J'utilise serial cloner (merci serialbasics) mais je ne trouve pas comment changer les couleurs des séquences soit les lettres ou surlignage dans la partie séquence soit les "flèches" sur le vecteur circulaire dans "graph map". Par contre j'ai trouvé dans "features" les couleurs pour les annotations des "features" dans grap map.
    Au secours "serialbasics" et meilleurs voeux
    Bonjour,

    en fait pour changer les couleurs utilisées par la carte graphique et la carte textuelle (ainsi que celles présentées dans la fenêtre de séquence), il faut modifier la couleur associé à la "feature" correspondante dans l'onglet de modification de annotation. Pour pouvoir modifier ces Features, il faut être dans le mode édition (cliquer sur "Edit")
    Est-ce que ça clarifie la chose ?

  21. #17
    lumioguninca

    Re : Programme de clonage

    Merci super
    c'est moi qui avait fait une fausse manoeuvre en créant un "feature" identique qui chevauchait l'original. Du coup sur la carte j'avais deux features au même endroit mais je changeais la couleur du mien qui était sous l'original.
    Suis-je clair?
    mais super logiciel, je peux même importer des format .ape ce qui rend complémentaires ces deux logiciels gratuits

    encore merci

  22. #18
    serialbasics

    Re : Programme de clonage

    Citation Envoyé par lumioguninca Voir le message
    Merci super
    c'est moi qui avait fait une fausse manoeuvre en créant un "feature" identique qui chevauchait l'original. Du coup sur la carte j'avais deux features au même endroit mais je changeais la couleur du mien qui était sous l'original.
    Suis-je clair?
    mais super logiciel, je peux même importer des format .ape ce qui rend complémentaires ces deux logiciels gratuits

    encore merci
    De rien ! Et merci pour le commentaire.
    à propos des superpositions de features (par exemple un tag dans une séquence, ect.) l'ordre dans lequel Serial Cloner va les dessiner est déterminé par l'ordre dans la liste de Features associées à la séquence. Les premières sont dessinées en premier et les dernières en dernier. On peut changer l'ordre en les glissant dans la liste.

  23. Publicité
  24. #19
    lumioguninca

    Re : Programme de clonage

    Bonjour

    Je continue à utiliser SerialCloner en parallèle avec Ape.
    SC est plus convivial et "esthétique" mais présente quelques bugs parfois horripilants:
    - quand on ouvre un fichier, la séquence s'affiche dans son cadre OK mais impossible d 'étirer la fenêtre vers le bas
    - la fonction"save" n'est pas pratique, parfois on veut "save as" mais comme il faut faire alt en même temps, ... alors c'est trop tard. Save et save as devrait se trouver sous un menu déroulant dans un onglet "enregistrer"
    - la fonction "undo" devrait être plus accessible dans la "toolbar par ex" plutôt que clic droit
    - le gros problème ce sont les insertions. Quand on veut placer une séquence dans une séquence d'un plasmide, souvent on perd des "features"n ou alors apparaît des "features prime: ex à attR1 s'ajoute attR1' et tout est décalé. Souvent je fais mes modif dans Ape et revient sur SC après. Mais si je fais scan, SC ne détecte pas des séquences atg .... stop de ma nouvelle prot
    - enfin et je ne sais pas si cela vient de mon ordi, j'ai le plus grand mal à sélectionner une séquence en partant du haut pour aller vers le bas, cela saute tout le temps. Quand je redescend pour agrandir ma séquence sélectionnée , le curseur remonte!!!
    je dois partir du bas pour aller vers le haut
    - pour les utilisateurs qui préfèrent le Mac (c'est aussi pour cela que je n'ai pas le reflèxe clic droit) au PC, beaucoup de fonctions en clic droit ne sont pas répertoriées dans le toolbar, comme reverse-complement (appelé ici antiparallel ce qui n'est pas explicite en plus car ou sont les fonctions reverse ou complement séparées?)
    bien cordialement

  25. #20
    lumioguninca

    Re : Programme de clonage

    Citation Envoyé par lumioguninca Voir le message
    Bonjour


    - la fonction"save" n'est pas pratique, parfois on veut "save as" mais comme il faut faire alt en même temps, ... alors c'est trop tard. Save et save as devrait se trouver sous un menu déroulant dans un onglet "enregistrer"
    - la fonction "undo" devrait être plus accessible dans la "toolbar par ex" plutôt que clic droit

    bien cordialement
    encore désolé, je n'avais pas vu l'autre barre d'outil (File Edit ...) quand on réduit la fenêtre. Si on ne réduit pas elle est cachée par la toolbar
    Ah là là ces PC!!!!!

  26. #21
    serialbasics

    Re : Programme de clonage

    merci pour ce retour.
    Je suis en train de mettre en place un forum SerialCloner pour permettre à chacun de partager ses expériences.

    - quand on ouvre un fichier, la séquence s'affiche dans son cadre OK mais impossible d 'étirer la fenêtre vers le bas
    C'est vrai mais il est possible de l'étendre vars la droite pour voir une fraction plus large de la séquence. Le bas est réservé aux infos de tradution

    - la fonction"save" n'est pas pratique, parfois on veut "save as" mais comme il faut faire alt en même temps, ... alors c'est trop tard. Save et save as devrait se trouver sous un menu déroulant dans un onglet "enregistrer"
    Apparemment, le menu est masqué sur votre système. J'ai un peu de mal à prévoir le comportement des PC sous windows je dois dire. Le Save as.. est disponible dans le menu Fichier. Le raccourci est toujours dispo (CTRL-MAJ-S), ainsi que le clic après ALT. Je crois qu'en général, les soft donnent moins d'option pour faire un Save As…

    - la fonction "undo" devrait être plus accessible dans la "toolbar par ex" plutôt que clic droit

    La encore, c'et sans doute un pb de menu maqué. Undo (et Redo) sont disponible dans le menu Edit. Mais pourquoi pas dans la toolbar en effet.

    - le gros problème ce sont les insertions. Quand on veut placer une séquence dans une séquence d'un plasmide, souvent on perd des "features"n ou alors apparaît des "features prime: ex à attR1 s'ajoute attR1' et tout est décalé. Souvent je fais mes modif dans Ape et revient sur SC après. Mais si je fais scan, SC ne détecte pas des séquences atg .... stop de ma nouvelle prot
    Oui, c'est un choix que j'ai fait est qui est discutable. Il faudrait peut-être que j'ajoute un réglage à ce propos dans les Prefs. Le pb est que, si on insère quelque chose dans une Feature, alors ce n'est plus la même Feature à mon sens et je voulais qu'il reste trace de cette action. Mais je pourrai le rendre paramétrable meêm si ça me semble risqué pour l'utilisateur.

    - enfin et je ne sais pas si cela vient de mon ordi, j'ai le plus grand mal à sélectionner une séquence en partant du haut pour aller vers le bas, cela saute tout le temps. Quand je redescend pour agrandir ma séquence sélectionnée , le curseur remonte!!!
    je dois partir du bas pour aller vers le haut

    Pour une fois, le pb est que tout allait trop site en effet. J'ai résolu ça pour la prochaine version.

    - pour les utilisateurs qui préfèrent le Mac (c'est aussi pour cela que je n'ai pas le reflèxe clic droit) au PC, beaucoup de fonctions en clic droit ne sont pas répertoriées dans le toolbar, comme reverse-complement (appelé ici antiparallel ce qui n'est pas explicite en plus car ou sont les fonctions reverse ou complement séparées?)
    En principe (si je n'ai rien oublié) toutes les fonctions sont accessibles dans le menu général (sous les chapitres Serial Cloner, File, Edit, Sequence, Features, Restriction, Function, Window). Les plus fréquentes sont en plus disponibles en menu contextuel, en raccourci clavier et dans la barre d'outils. La encore, j'ai essayé de donner beaucoup de possibilités aux utilisateurs (par exemple, j'utilise beaucoup les menus contextuels, mais visiblement pas vous).
    Pour le menu 'Antiparallel', Le 'Reverse-Complement' s'est imposé dans certains logiciels mais n'a aucun sens biologique (aucune enzyme ne peut faire un 'Reverse'). Le terme exact est 'Antiparallel' que j'ai donc choisi dans Serial Cloner.

    Un point plus général, n'hésitez pas à vous servir de la fenêtre d'aide contextuelle (Help). Il suffit de faire passer la souris sur certains éléments de la fenêtre pour avoir des informations et astuces.

    Et n'hésitez pas à me contacter par MP pour plus d'info même si cette discussion publique permet à tous d'en profiter.
    Dernière modification par LXR ; 26/01/2011 à 22h53.

  27. #22
    Poussin60

    Re : Programme de clonage

    Bonjour serialbasics

    Je suis à la recherche d'un guide d'utilisateur pour Serial Cloner.
    Je me suis procuré le PDF "Serial Cloner 1.2 User Manual Part I : Basic functions" sur le site de téléchargement du logiciel.

    Nous sommes plusieurs dans notre laboratoire à utiliser ce logiciel mais aucun d'entre nous ne sait l'exploiter pleinement.
    Je voulais savoir si vous aviez rédigé un manuel plus complet, dans lequel seraient présentées les différentes fonctionnalités du logiciel ainsi que leurs utilités respectives, suivant l'utilisation que l'on veut en faire in fine.

    Merci beaucoup
    Cordialement

  28. #23
    serialbasics

    Re : Programme de clonage

    Bonjour,

    désolé, je n'avais pas vu ce message supplémentaire.
    Oui, désolé pour le manque de notice mais je développe ce logiciel "à temps perdu" et écrire une notice prends au moins autant de temps que d'ajouter (et corriger) des fonctionnalités.
    Il y a une aide contextuelle qui peut beaucoup vous aider (en passant le pointeur au dessus d'un bouton ou d'un champs, vous aurez une aide qui correspond à cette fonction).
    Et n'hésitez pas à me contacter (voir l'adresse dans la boite 'About Serial Cloner'). J'essaierai de vous aider rapidement,
    Bons clonages,
    Franck

  29. #24
    Poussin60

    Re : Programme de clonage

    bonjour

    En fait, j'ai finalement parcouru les différentes fonctionnalités par moi-même et étant donné que celles-ci sont assez intuitives, je n'ai pas eu trop de mal ^^.
    J'ai même rédigé une notice perso en français pour mes collègues (librement adaptée de la votre en anglais, en espérant que vous n'y voyiez pas d'inconvénient. Je pourrais aussi vous la transmettre si vous êtes interessé pour l'adapter et en faire profiter les internautes).

    Je voudrais également vous faire part d'un souci que j'ai rencontré au niveau des librairies de "Features". J'utilise la fonction "Scan" afin de cartographier rapidement tous les plasmides de ma banque.
    J'ai récemment remarqué que certaines séquences pré-enregistrées n'était pas tout à fait en accord avec les séquences consensuelles trouvées dans la littérature scientifique. Cela ne se joue parfois qu'à un ou deux nucléotides, mais cela est suffisant pour que la séquence entière ne soit pas reconnue.
    Je vous donne un exemple : en voulant cartographier le plasmide pEGFP-N1 de Clontech (http://www.clontech.com/images/pt/di...s/PT3027-5.pdf), j'ai remarqué qu'après un Scan, le promoteur CMV n'apparaît pas. En effet, la séquence consensuelle diffère de celle de la librairie d'un seul nucléotide (en position 509 de votre séquence, il y a un C, alors que c'est un G dans la séquence consensuelle).

    Ayant quelques centaines de plasmides à répertorier, procéder à des alignements de séquence pour chacun d'entre eux me prendrait beaucoup de temps.

    Serait-il possible que le logiciel passe outre ce genre de problème (dans la limite du raisonnable bien sûr) ?
    Si tel est déjà le cas, comment peut-on procéder ?

    Merci
    cordialement

  30. Publicité
  31. #25
    lumioguninca

    Re : Programme de clonage

    Bonjour

    J'utilise actuellement Serial Cloner pour mes manip de recombinaison Gateway LR.

    Or sur un pDONR 223-X (donc un pENTR) se terminant au niveau du attL2 par:
    tacccaactttcttgtacaaagttggcattat aagaaagcattgcttatcaatttgttgcaa cgaacaggtcactatcagtcaaaataaaat cattattt
    je n'ai aucun problème
    avec un autre pDONR 223§Y se terminant par :
    tgcccaactttcttgtacaaagttggcattat aagaaagcattgcttatcaatttgttgcaa cgaacaggtcactatcagtcaaaataaaat cattattt
    il me répond dans le menu recombinaison :"Checking (attL1,attL2): error"

    or la seule différence est le g qui si il est a donne un attL2 valide.
    Il ne me semble pas cependant que cette base soit essentielle pour une recombinaison pDEST/pENTR.

    Qu'en pensez-vous sachant que pour l'instant tous nos clonages Gatway ont super bien marché alors que d'après serial Cloner ce ne serait pas possible

    merci
    bien cordialement

Discussions similaires

  1. [Biologie Moléculaire] Clonage
    Par glaukia dans le forum Biologie
    Réponses: 0
    Dernier message: 06/05/2008, 15h49
  2. Clonage clonage clonage est ce c’est vraie ou non ???
    Par lovelysarah dans le forum Biologie
    Réponses: 1
    Dernier message: 12/04/2007, 18h35
  3. Clonage
    Par mimie762 dans le forum TPE / TIPE et autres travaux
    Réponses: 2
    Dernier message: 28/09/2006, 12h36
  4. Premier clonage de cellules souches : la course au clonage humain s'accélère
    Par RSSBot dans le forum Commentez les actus, dossiers et définitions
    Réponses: 0
    Dernier message: 23/05/2005, 09h13
  5. Clônage
    Par cariana dans le forum Discussions scientifiques
    Réponses: 3
    Dernier message: 07/09/2004, 11h03