Répondre à la discussion
Affichage des résultats 1 à 20 sur 20

Bioinformatique



  1. #1
    kady.bio

    Question Bioinformatique


    ------

    Bonjour à tous,

    J'ai un TP d’initiation à la bioinformatique. D’abord, il faut analyser un fragment de génome anonyme et essayer d’en tirer le maximum d’informations possibles (espèce, nature du gène, les sites de restriction…etc.), comparer cette séquence avec d’autres séquences de références connues (alignement multiple), par la suite essayer de comparer les protéines associées et d’établir l’arbre phylogénétique la plus proche du point de vue évolutive pour ces protéines.

    Séquence anonyme 1 :
    CGGTTTTTTTCAGTCTCATGACACTTCGTG ATCATTGAGGGTCTGATGAG
    CACTGTTCATGCCATCACAGCCACTCAGAA GACCGTGGACGGCCCATCTGGCAAGCTGTG GAGAGATGGCCGTGGTGCCAGCCAGAACAT CATCCCTGCCTCTACTGGCGCTGCCAAGGC TGTGGGCAAGGTCATCCCTGAGCTTAATGG TAAGCTGACTGGCATGGCCTTCCGTGTCCC CACCCCCAACGTATCCGTTGTTGACCTGAC TGTCCGTCTGGAGAAACCAGCCAAGTATGA AGACATCAAGAAAGTGGTCAAGGCCGCAGC AGATGGCCCAATGAAGGGATTCCTGGGATA CACAGATCATCAGGTGGTGTCCACAGATTT CAACGGCGATTGCCGCTCCTCCATCTTTGA TGCTGGCGCTGGCATTGCCCTGAATGATCA CTTCGTCAAGCTGGTCACATGGTACGACAA CGAATGCGGGAAA

    Avez vous quelque chose pour me faire avancer ??

    Merci

    -----

  2. Publicité
  3. 📣 Nouveau projet éditorial de Futura
    🔥🧠 Le Mag Futura est lancé, découvrez notre 1er magazine papier

    Une belle revue de plus de 200 pages et 4 dossiers scientifiques pour tout comprendre à la science qui fera le futur. Nous avons besoin de vous 🙏 pour nous aider à le lancer...

    👉 Je découvre le projet

    Quatre questions à explorer en 2022 :
    → Quels mystères nous cache encore la Lune 🌙 ?
    → Pourra-t-on bientôt tout guérir grâce aux gènes 👩‍⚕️?
    → Comment nourrir le monde sans le détruire 🌍 ?
    → L’intelligence artificielle peut-elle devenir vraiment intelligente 🤖 ?
  4. #2
    Clairounouette

    Re : Bioinformatique

    En fait, je ne comprends pas trop...c'est un TP d'initiation à l'informatique, donc tes comparaisons doivent être faites en utilisant le logiciel, non?

  5. #3
    Moumoutte

    Re : Bioinformatique

    Bonjour,

    on ne t'a donné aucun site, aucun lien, sur lesquels tu peux effectuer ce genre de recherche? ça m'étonne...

    Cordialement

  6. #4
    MaliciaR

    Re : Bioinformatique

    Citation Envoyé par kady.bio Voir le message
    Bonjour à tous,

    J'ai un TP d’initiation à la bioinformatique.
    J'ai l'impression qu'on t'avait un peu aiguillé sur un autre site, non?
    Un truc comme faire un BLAST contre un banque de séquences, si je ne m'abuse...

    Visiblement, il y a quelque chose qui coince, alors bon, dis ce que c'est. On t'aidera mieux, mais il faut que tu y mettes du tien
    An expert is one who knows more and more about less and less.

  7. A voir en vidéo sur Futura
  8. #5
    sseebbaa

    Re : Bioinformatique

    blast
    clustalw

    Pour aller plus loin :
    http://www.brc.dcs.gla.ac.uk/~mallik...ics-tools.html

    Bon sinon je refuse d'appeler ça de la bioinfo, mais plus du clic bouton pour biologiste !

  9. #6
    MaliciaR

    Re : Bioinformatique

    Citation Envoyé par sseebbaa Voir le message
    Bon sinon je refuse d'appeler ça de la bioinfo, mais plus du clic bouton pour biologiste !
    Euh... Tu veux quoi? Qu'en un mois on apprenne aux étudiants de programmer...? Je ne vois pas où est problème de l'appelation. C'est un nom générique pour dire qu'on se sert d'outils bioinformatiques déjà prêts et qu'on ne les fait pas forcément.
    An expert is one who knows more and more about less and less.

  10. Publicité
  11. #7
    sseebbaa

    Re : Bioinformatique

    Citation Envoyé par MaliciaR Voir le message
    Euh... Tu veux quoi? Qu'en un mois on apprenne aux étudiants de programmer...? Je ne vois pas où est problème de l'appelation. C'est un nom générique () pour dire qu'on se sert d'outils bioinformatiques déjà prêts et qu'on ne les fait pas forcément.
    C’est bien ça qui me gêne après les profs osent dire que c’est de la bio-informatique, il en faut pour tous les goûts mais ce n’est pas le mien
    Appelons-le : Initiation aux outils bioinformatiques
    Sinon perso j’ai commencé en javascript à faire des brins complémentaires, ce n’est quand même pas sorcier et je trouve beaucoup plus valorisant.

  12. #8
    kady.bio

    Question Re : Bioinformatique

    Bonjour,
    Je tiens à vous remercier pour vos réponses. En effet, on vient d’entamer le module de la bioinformatique. Dans ce module, on ne fait rien, à part étudier des articles où on se sert de la bioinformatique. Or je n’ai, encore, aucune idée sur ce qu’est la bioinformatique (à part peut-être se servir de l’outil informatique à des fins en biologie, mais cela ne m’aide pas trop).
    Alors les liens que j’ai, dans ce TP d’initiation, sont :
    www.ncbi.nlm.nih.gov.genbank : pour les séquences nucléiques.
    www.ncbi.nlm.nih.gov.genome : pour les banques de génomes.
    www.ncbi.nlm.nih.gov.dbEST : EST – Expressed Sequence Tags pour les marqueurs d’expression
    (je me demande d’ailleurs comment utiliser ces 3 liens, parce qu’ils ne ressemblent qu’en partie à des URL)

    www.ebi.ac.uk : EBI Européen Bioinformatiques qui contient toutes les séquences nucléiques expérimentales
    www.genome.ucsc.edu/ : banque de génomes.
    www.expasy.org/sprot/: pour les séquences protéiques.
    www.rcsb.org/pdb/home/home.do : pour les structures protéiques.

    Sinon, j’ai fait un blast, mais je ne sais pas quoi en faire, ni quoi faire à la suite.
    Comprenez bien que j’ai besoin de la démarche complète à suivre pour apprendre à me servir de la bioinformatique mais aussi pour réaliser ce TP. Alors si vous avez des cours ou des tutoriaux, je suis preneuse.

    Je vous remercie d’avance.

  13. #9
    piwi

    Re : Bioinformatique

    Quels sont les paramètres de votre BLAST et quel résultat vous donne-t-il?
    Je l'ai fais moi même et il m'a permis d'identifier la protéine et l'espèce. Si vous n'avez pas cela c'est que vous avez un souci et on vous aidera à le résoudre puis à avancer pas à pas.

    Bienvenue dans la bioinfo
    piwi
    Je sers la science et c'est ma joie.... Il parait.

  14. #10
    kady.bio

    Re : Bioinformatique

    Le résultat que j'obtiens en faisant le blast est montré sur la capture ci-dessous. Mais comment est ce qu'on peut déterminer la bonne protéine? est ce qu'on se base sur un critère en particulier? les pourcentages sont-il pris en considération?




  15. #11
    piwi

    Re : Bioinformatique

    Vous avez la bonne protéine mais avez vous pensé à regarder les options avant de lancer la recherche?
    Pour faire simple, regardez la colonne "max ident" (identity). Le gène qui ressemble le plus à votre séquence lui est identique à 81%. Si c'était le bon gène se serait 100%.
    J'ai l'impression que vous n'avez comparé votre séquence qu'à une banque humaine. Et si votre protéine était une GAPDH d'une autre espèce animale?

    Cordialement,
    piwi
    Je sers la science et c'est ma joie.... Il parait.

  16. #12
    kady.bio

    Re : Bioinformatique

    je voudrais bien affiner ma recherche, mais je ne sais pas comment faire. Tu n'aurais pas des liens d'initiation à la bioinformatique? je pose la question parce que google ne m'a pas été d'une grande aide. Donc si jamais tu as des liens (peut-être du web invisible ou web profond), alors ce ne serait pas de refus. Merci à toi d'avoir suivi ce fil.

  17. Publicité
  18. #13
    piwi

    Re : Bioinformatique

    Non je n'ai pas de lien particulier à vous suggérer je me base sur mon expérience du programme. Lisez quand même la doc du site si vous avez du mal à l'utiliser.

    Maintenant sur la page NCBI, on vous propose trois choses:
    Human genomic + transcript
    Mouse genomic + transcript
    others (autre).

    Comme vous n'avez aucun a priori il vous faut aller vers la troisième option. Ensuite il vous faut affiner dans la barre en dessous. Deux options semblent pouvoir convenir.
    nr/nt va comparer votre séquence par rapport à des séquences génomiques connues. On renvoie donc un gène d'une espèce en réponse.
    reference genomic sequences va comparer à des séquences chromosomiques connues. On renvoie donc des chromosomes d'une espèce en réponse.
    Sachant cela vous choisirez donc la première option.

    Envoyez le BLAST et essayez de progresser avec les infos. On verra ensuite si vous bloquez et ce que l'on peut faire.
    Je sers la science et c'est ma joie.... Il parait.

  19. #14
    kady.bio

    Re : Bioinformatique

    En suivant les étapes que vous venez de m'indiquer, je suis tombée sur "*Sardina pilchardus glyceraldehyde-3-phosphate dehydrogenase (GAPDH)" avec "Max ident" à 100%. Est ce que j'ai réussi à identifié la séquence en question? La démarche étant très simpliste, je me demande si j'étais passée à coté de quelque chose. Que dois-je apprendre au juste? Merci d'éclairer ma lanterne.
    Dernière modification par kady.bio ; 15/03/2009 à 22h16.

  20. #15
    piwi

    Re : Bioinformatique

    Yes!
    Alors maintenant que faire?
    Il y a quelques questions qui se posent. Une des premières est, où se trouve votre fragment dans le gène? (pas certain que le génome de la sardine ait été séquencé, mais celui de l'homme l'a été ).
    Je sers la science et c'est ma joie.... Il parait.

  21. #16
    kady.bio

    Re : Bioinformatique

    Merci infiniment pour votre aide.
    Et oui j’ai d’autre questions, comme :
    Comment trouver les différents cadres de lecture possibles pour la traduction de cette séquence.

  22. #17
    piwi

    Re : Bioinformatique

    Vous avec Expasy (qui se trouve d'ailleurs dans votre liste) qui fait cela très bien. Mais je pense que c'est un peu prendre le problème à l'envers. Comme pour l'instant nous sommes sur du génomique il n'est pas dit qu'une partie de la séquence, voir toute la séquence, ne soit pas intronique. Le mieux est de commencer par la situer sur le gène et d'essayer d'y repérer les introns pour pouvoir en déterminer la part transcrite. Je ne dis pas que ça puisse être fait facilement mais ça peut être fait rapidement au moins grossièrement dans un premier temps.
    Je sers la science et c'est ma joie.... Il parait.

  23. #18
    kady.bio

    Re : Bioinformatique

    Est-ce que c’est possible, svp, de savoir comment utiliser Expasy pour avoir la bonne séquence peptidique à partir de ma séquence nucléotidique

  24. Publicité
  25. #19
    piwi

    Re : Bioinformatique

    Si on procède totalement par soit même il y a un tout petit peu de boulot pour sortir la séquence peptidique de votre truc. Sinon on peut passer par les résultat du BLAST que vous avez déjà fait pour trouver presque instantanément. Cela dit je vous conseille de procéder par vous même, il y a un petit passage piégeux sur lequel il est sans doute intéressant de s'échouer un instant.

    Qu'avez vous fait depuis la dernière fois?
    Je sers la science et c'est ma joie.... Il parait.

  26. #20
    kady.bio

    Re : Bioinformatique

    J’ai fais un blast de ma séquence nucléotidique ce qui m’a permit de déterminer le gène et l’espèce ainsi que différents autre informations. Ensuite j’ai translaté ma séquence en cherchant l’ORF et j obtenue cette séquence peptidique :

    43 ctgatgagcactgttcatgccatcacagcc actcagaagaccgtg
    L M S T V H A I T A T Q K T V
    88 gacggcccatctggcaagctgtggagagat ggccgtggtgccagc
    D G P S G K L W R D G R G A S
    133 cagaacatcatccctgcctctactggcgct gccaaggctgtgggc
    Q N I I P A S T G A A K A V G
    178 aaggtcatccctgagcttaatggtaagctg actggcatggccttc
    K V I P E L N G K L T G M A F
    223 cgtgtccccacccccaacgtatccgttgtt gacctgactgtccgt
    R V P T P N V S V V D L T V R
    268 ctggagaaaccagccaagtatgaagacatc aagaaagtggtcaag
    L E K P A K Y E D I K K V V K
    313 gccgcagcagatggcccaatgaagggattc ctgggatacacagat
    A A A D G P M K G F L G Y T D
    358 catcaggtggtgtccacagatttcaacggc gattgccgctcctcc
    H Q V V S T D F N G D C R S S
    403 atctttgatgctggcgctggcattgccctg aatgatcacttcgtc
    I F D A G A G I A L N D H F V
    448 aagctggtcacatggtacgacaacgaatgc gggaaa 483
    K L V T W Y D N E C G K

    J’ai fais après un alignement « BLAST » de l’ORF pour la validation mon gène.
    Il me reste maintenant à déterminer le codon d’initiation et le codon stop.

    Tout ce travail a été réalisé en utilisant la banc d’NCBI. Sauf que je dois faire une comparaison avec d’autres bancs. La raison pour laquelle je vous demande de m’informer sur comment je dois utiliser Expasy puisque c’est la 1ere fois que je le découvre.

Discussions similaires

  1. [Génétique] bioinformatique
    Par Musicalling dans le forum Biologie
    Réponses: 1
    Dernier message: 14/09/2016, 12h54
  2. bioinformatique
    Par Dealz dans le forum TPE / TIPE et autres travaux
    Réponses: 0
    Dernier message: 07/10/2012, 14h44
  3. [Divers] Bioinformatique
    Par futurette dans le forum Biologie
    Réponses: 3
    Dernier message: 14/03/2009, 19h42
  4. [Exercice] Bioinformatique
    Par mrima dans le forum Biologie
    Réponses: 1
    Dernier message: 02/01/2009, 13h18
  5. [Divers] la bioinformatique
    Par manou24 dans le forum Biologie
    Réponses: 4
    Dernier message: 26/12/2007, 21h57
Découvrez nos comparatifs produits sur le sport et la santé.