Répondre à la discussion
Affichage des résultats 1 à 14 sur 14

qPCR :



  1. #1
    meryaaam

    qPCR :

    Bonjour Tout le monde

    j'essaye de quantifier l'expression d'un gène par qPCR, j'ai commandé jusqu'ici 3 paires de primers (que j'ai designé avec un logiciel spécial), mais je n'arrive pas à l'amplifier.
    Sachant que je sais que cette proteine est exprimée dans l'organe d'où j'ai extrait l'ARN, et que mon ARN (et mon ADNc) est de bonne qualité, je ne comprends pas pourquoi au bout de la 3eme paire de primers designées j'arrive toujours pas a amplifier mon gene d'interet.

    Help!

    -----


  2. Publicité
  3. #2
    Flyingbike

    Re : qPCR :

    Citation Envoyé par meryaaam Voir le message
    Bonjour Tout le monde

    j'essaye de quantifier l'expression d'un gène par qPCR, j'ai commandé jusqu'ici 3 paires de primers (que j'ai designé avec un logiciel spécial), mais je n'arrive pas à l'amplifier.
    Sachant que je sais que cette proteine est exprimée dans l'organe d'où j'ai extrait l'ARN, et que mon ARN (et mon ADNc) est de bonne qualité, je ne comprends pas pourquoi au bout de la 3eme paire de primers designées j'arrive toujours pas a amplifier mon gene d'interet.

    Help!
    tu as essayé d'amplifier un gene de contrôle sur ces échantillons ?

    Si tu veux donne moi la séquence de tes amorces et la ref de ton gène et je jetterai un coup d'oeil

  4. #3
    meryaaam

    Re : qPCR :

    Oui, j'ai amplifié une vingtaine de gènes a partir du meme template(et en meme temps) et ça marche très bien.
    Mon probleme concerne la protéine MIWI (chez la souris), lien vers le cDNA:

    http://www.ensembl.org/Mus_musculus/...UST00000086056

    Paire 1
    left: CTCAAGTCAGTCGGGAGAGG
    right: CAGGCCACTGCTGTCATAGA

    Paire 2
    left: ATGGTAGTCGGAGCCACATC
    right: GGTGCTCAGCTTCACAATGA

    Paire 3
    left: ACCAGAATCCAAAGAGCACC
    right:GAGATAGCAGAGTTCAGGGATG


    Merci beaucoup pour ton aide!

    Meryam

  5. #4
    Flyingbike

    Re : qPCR :

    A priori tes 3 paires sont bien dans le cDNA, l'amplicon fait la bonne taille, le %GC est nickel, le Tm pareil...

    Théoriquement ça devrait marcher. Quand tu dis que tu n'y arrives pas, quel est le résultat ?

    Les explications possibles :

    -tu as un transcrit alternatif ou un variant d'épissage dans ton tissu mais je n'y crois pas sachant que les 3 paires amplifient des régions différentes du messager.

    -le gène n'est pas exprimé (mais apparamment il l'est, non ?)

    -le gène est bien là mais en petite quantité : comment fais tu ta RT ? (qté d'ARN, quelle dilution ...?)

    -le programme de qPCR n'est pas adapté (quelle machine, quel Tm, combien de cycles ...?)

  6. #5
    meryaaam

    Re : qPCR :

    pour la RT, je prends 2µg d'ARN que je retrotranscrit avec des "Random primers" puis je fais ma qPCR soit avec mon template non dilué, soit dilué au 10eme.
    Dans tous les cas, avec les primers 1 et 3, j'ai pas d'amplification du tout (genre un Ct de 38/39 sur 40 cycles; et quand je depose sur gel y a rien), et avec les primers 2 j'ai une amplification non spécifique et très tardive.
    sinon j'utilise la machine applied biosystems, j'ai dejà essayé d'optimiser le programme mais ça change rien.
    Et je suis sûre que la protéine est présente dans les testicules, d'où j'ai extrait l'ARN.
    Je me damandais si l'ARNm ne formait pas des structures secondaires ou un truc dans le genre.

    Merci!

  7. A voir en vidéo sur Futura
  8. #6
    Flyingbike

    Re : qPCR :

    Je n'ai pas d'idée alors... Pour les structures secondaires, n'oublie pas qu'il y a plusieurs étapes à 95° donc je ne pense pas que ça soit le cas. Si j'ai une idée je reviens

  9. Publicité
  10. #7
    meryaaam

    Re : qPCR

    Il se peut que le problème vienne de l'age de la souris, j'ai regardé dans des papiers, et c'est vrai qu'ils ne precisent pas l'age des souris d'ou ils ont extraits l'ARNm, à part dans un des articles où ils prelevent les testicules dans des souris de moins d'un mois alors que moi je l'ai fait chez une souris qui devait avoir 2mois et demi. Peut être que MIWI n'est plus exprimée un mois post naissance...

  11. #8
    LXR

    Re : qPCR :

    Je te conseille de pousser le nombre de cycles jusqu'à 50 cycles. En effet, quel intérêt de regarder des Ct qui sortent vers 38-39 cycles si ta PCR s'arrête à 40 cycles tout en voulant avoir une courbe de fusion correcte?

    Personnellement, mes qPCR comprennent 50 cycles. Au-dessus de 40 cycles je n'ai jamais eu de résultat précis et interprétable. Par contre pour des gènes sortant entre 30 et 40 cycles, c'est très intéressant puisque j'arrive à obtenir des courbes de fusion parfaites, grâce aux 50 cycles. En effet si tu regardes ta courbe dF = f(C) qui est la courbe de quantification de l'émission de fluorescence en fonction du nombre de cycles, tu verras qu'une fois le Ct passé, avant d'arriver à saturation de la PCR (courbe parallèle à l'axe des abscisses), tu comptes environ 5-6 cycles. Pendant ces 5-6 cycles la quantité d'amplicons augmente considérablement. Etant donné que l'aire sous la courbe de fusion (intégration de l'équation dF/dT = f(Température)) est proportionnelle à la quantité d'amplicon généré, il est évident qu'arriver à saturation de la PCR permet d'avoir un pic d'intensité plus forte, plus propice à être résolu.

    Mes 10 cycles supplémentaires n'ont donc pour but que d'avoir une belle courbe de fusion, précise, qui permet de voir d'autant mieux la présence de produits non spécifiques. Le plus couramment utilisé est 40 cycles mais j'ai pu voir dans quelques publications des auteurs pousser jusqu'à 50 cycles, ce qui m'a décidé de faire pareil.

    Pour le design de primers, je suis très satisfait de la Primer Bank de l'Université d'Harvard, qui offre la plupart du temps 3 paires de primers pour chaque gène. Pour une des trois paires, ils ont fait une vérification de la taille de l'amplicon sur gel d'agarose avec un automate (pas toujours). En tous les cas, je te conseille tout de même de les blaster par pure précaution. Jusqu'à là je suis satisfait.

    Greg

  12. #9
    meryaaam

    Re : qPCR :

    Merci Greg
    En effet, la primer Bank est vraiment très bien.
    Je suivrai tes conseils pour les 50 cycles.

  13. #10
    meryaaam

    Re : qPCR :

    J'ai fait la qPCR avec les 50 cycles (et les 3 paires de primers) et j'ai toujours des courbes de dissociations affreuses.
    Meme sur la primer bank, il y a une courbe de dissociation d'un des primers qu'ils proposent (qui a été validé experimentalement), et sincerement la courbe de dissociation est étrange (http://pga2.mgh.harvard.edu:8080/rtp...rId=10946612a1)
    Je pense que je ferai de la RT PCR semi quantitative à la place pour esperer avoir une quantification a peu pres correcte!

  14. #11
    Lord M

    Re : qPCR :

    Salut,

    Après toutes ces précisions, il est vraiment étonnant que tu n'arrives pas à amplifier l'ARN si le gène est bien exprimé dans les cellules. Les amorces sont bien, et tu as essayé à peu près toutes les astuces connues pour optimiser une PCR ^^

    Si tu as accès à ce type de matériel, il pourrait être intéressant d'essayer un western blot sur tes cellules (détection de la protéine) ou un northern blot (détection des ARN).
    Lord M

    What we do in life echoes in eternity

  15. #12
    LXR

    Re : qPCR :

    Citation Envoyé par meryaaam Voir le message
    Meme sur la primer bank, il y a une courbe de dissociation d'un des primers qu'ils proposent (qui a été validé experimentalement), et sincerement la courbe de dissociation est étrange (http://pga2.mgh.harvard.edu:8080/rtp...rId=10946612a1)
    En effet, le profil légérement dédoublé du pic est typique de l'amplification de deux produits différents. Vu son intensité, il modifie la valeur du Ct et le résultat obtenu est donc faux.Cette banque a donc le mérite d'être honnête en toute circonstance. Pour le moment je n'ai pas eu de gènes où les primers proposés par la Primer Bank avaient de tels profils.

    Je viens de remonter un peu dans le fil et n'ai pas vu le terme "Blast"....As-tu blasté tes primers? Le profil dédoublé de la courbe de fusion m'oriente d'autant plus vers les amplifications non spécifiques qui parasitent ta PCR. Blaste tes primers et donne nous les e-value qui sortent, et surtout si c'est bien ton gène qui arrive en tête de liste l'idéal étant une e-value inférieure à 0.001.

    Greg

  16. Publicité
  17. #13
    Flyingbike

    Re : qPCR :

    j'ai vérifié la spécificité des primers et c'est OK.

  18. #14
    meryaaam

    Re : qPCR :

    Merci tout le monde!
    Ca restera une enigme, quoique pas tant que ça, je suis sûre que c'est lié à un probleme de niveau d'expression... Dans la litterature aucun papier ne fait de qPCR sur miwi, mais j'ai pu voir des blots et des coupes d'histochimie, ou encore de la pcr toute simple pour voir si Miwi est exprimée ou pas.
    Je vous tiendrai au courant si j'ai du nouveau

Sur le même thème :

Discussions similaires

  1. [Biologie Moléculaire] RTQPCR ou RT+QPCR
    Par malesore dans le forum Biologie
    Réponses: 5
    Dernier message: 05/05/2008, 12h24
  2. [Divers] 3C-RT-qPCR?
    Par MaliciaR dans le forum Biologie
    Réponses: 1
    Dernier message: 05/04/2008, 20h14
  3. [Biologie Moléculaire] QPCR, courbe Tm?
    Par fallbalah dans le forum Biologie
    Réponses: 8
    Dernier message: 31/03/2008, 20h14
  4. [Biologie Moléculaire] primers qPCR
    Par gorben dans le forum Biologie
    Réponses: 3
    Dernier message: 22/01/2008, 19h00
  5. [Biologie Moléculaire] qPCR
    Par valkien dans le forum Biologie
    Réponses: 10
    Dernier message: 07/01/2008, 23h20