Répondre à la discussion
Affichage des résultats 1 à 6 sur 6

Amorce sens et antisens



  1. #1
    emilly 2

    Amorce sens et antisens

    Bonsoir à tous

    En ce qui concerne les amorces sens et antisens , je ne comprend pas pourquoi l'amorce sens est identique à la séquence cible tend dis ce que
    l'amorce antisens et complementaire à la sequence cible pourtant les 2 amorces doivent hybrider avec l'ADN complémentaire pour débuter la réaction PCR .Je ne sais pas est ce que ma question est claire ou non mais lors de la comparaison de mais amorces avec les sequence cibles sur le site NCBI voila ce que j'ai trouvé:

    amorce sens : GCATGACGTTATTTATGAGATGGG en rouge

    amorce antisens : GACACCGCGCGCGATAATTTATCC en bleu

    ORIGIN

    1 ccagttaggc cagttaccca gatctgagtc gacctgcaga tcgttcaaac atttggcaat

    61 aaagtttctt aagattgaat cctgttgccg gtcttgcgat gattatcata taatttctgt

    121 tgaattacgt taagcatgta ataattaacatgtaatgcatgacgttatttatgagatggg

    181 tttttatgat tagagtcccg caattatacatttaatacgcgatagaaaac aaaatatagc

    241 gcgcaaacta ggataaattatcgcgcgcggtgtcatctatgttactagatctgggcctcg

    301 tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg

    361 gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaaatacattcaa




    merci d'avance

    -----


  2. Publicité
  3. #2
    kamor

    Re : Amorce sens et antisens

    Non une amorce s'hybride sur ce brin, l'amorce antisens, et l'amorce sens s'amorce sur le brin sens. Ainsi il y aura amplification de l'amplicon à la fin de la PCR
    Pour le côté visuel de la chose, je vous invite à regarder ce site
    http://www.chups.jussieu.fr/polys/bi...Y.Chp.8.3.html
    Dernière modification par kamor ; 24/02/2010 à 19h25.

  4. #3
    emilly 2

    Re : Amorce sens et antisens

    C'est bien illustré Kamor
    Merci beaucoup , je te trouve toujours à mes cotés

  5. #4
    kamor

    Re : Amorce sens et antisens

    Ah bon? Ca me fait peur alors, j'ai l'impression de passer trop de temps sur le forum alors
    De rien, j'avais eu aussi le même problème sur la répartition des amorces au départ la première fois qu'un prof me l'a expliqué en 4min 30.

  6. #5
    emilly 2

    Re : Amorce sens et antisens

    salut Kamor

    j'ai pris tu temps pour vous répondre car mon mot de passe s'est bloqué , je vient de le modifier. bref , je ne sais pas pourquoi vous avez eu peur ,c'est au contraire le fait de bien maitrisé le domaine remonte le morale . De ma part , je commence a dopé sur le forum parce que je trouve que c'est très utile et il m'arrive souvent de poser des question propre à moi dont les réponses ne se trouve pas sur le net car on a besoin d'une personne qui a bloqué devant le même problème.

    cordialement ,

  7. A voir en vidéo sur Futura
  8. #6
    kamor

    Re : Amorce sens et antisens

    C'était une boutade, j'ai appris beaucoup sur le net, dans les publis et aussi et surtout grâce à des collègues dans des labos. C'est un peu le même principe ici mais en plus grand donc beaucoup plus enrichissant. Et si je peux donner une info utile de temps en temps, tant mieux

  9. Publicité

Sur le même thème :

Discussions similaires

  1. [Biologie Moléculaire] brin sens / brin antisens
    Par mimismall dans le forum Biologie
    Réponses: 17
    Dernier message: 13/01/2013, 19h31
  2. [Biologie Cellulaire] brin sens/antisens
    Par GeantVert38 dans le forum Biologie
    Réponses: 1
    Dernier message: 22/11/2009, 12h07
  3. [Génétique] ARN antisens
    Par O!ivier dans le forum Biologie
    Réponses: 3
    Dernier message: 30/05/2008, 18h01
  4. [Biologie Moléculaire] RNAi Vs RNA antisens
    Par Jasoda dans le forum Biologie
    Réponses: 1
    Dernier message: 28/11/2007, 11h26
  5. effet Antisens. A l'aide!
    Par zobi-la-mouche dans le forum Biologie
    Réponses: 3
    Dernier message: 26/04/2007, 10h11