Répondre à la discussion
Affichage des résultats 1 à 1 sur 1

Proteine de Fusion Besoin d'aide



  1. #1
    Nguyen.Olivier

    Proteine de Fusion Besoin d'aide


    ------

    bonsoir a tous, j'ai un exercice a faire concernant la production d'une proteine de fusion, GFP-GST.

    j'ai comme vecteur pGEX-4T-2 (lien ci dessous)
    http://www.google.fr/imgres?q=pGEX-4...:429,r:5,s:117

    et le vecteur pEGFP-N1
    http://www.google.fr/imgres?q=pEGFP-...1t:429,r:5,s:0


    j'ai donc utilisé les enzymes de restriction coupant au niveau du sites EcoRI de pGEX. afin d'inserer mon gène EGFP qui possède dans sa partie MCS, un site de restriction EcoRI egalement. mais je ne sais pas comment couper, apres le gène EGFP pour qu'il soit complementaire de la sequence de l'extremité colante correspondante sur pGEX.

    dans mon énoncé, je dispose d'amorce, et je ne sais pas si je dois les utiliser. de plus je n'ai pas compris comment cela fonctionne.
    amorce GFP5: TAGCGCTACCGGACTCAGAT position 593-613 dans pEGFP-N1
    amorce GFP3: CAAATGTGGTATGGCTGATTATG position 1440-1417 dans pEGFP-N1
    amorce PGEX5: GCTGGCAAGCCACGTTTGGTG position 869-891 dans pGEX-2T
    amorce pGEX3: GGAGCTGCATGTGTCAGAGG position 1042-1020 dans pGEX-2T

    doit on utiliser les amorces ou doit ont couper tout simplement pEGFP-N1 a Not 1 ou XBA1 situé quelque nucleotide apres EGFP. sachant que il existe un site de restriction Not1 sur pGEX-4T-2 ?

    merci de bien vouloir m’éclairer

    -----

  2. 📣 Nouveau projet éditorial de Futura
    🔥🧠 Le Mag Futura est lancé, découvrez notre 1er magazine papier

    Une belle revue de plus de 200 pages et 4 dossiers scientifiques pour tout comprendre à la science qui fera le futur. Nous avons besoin de vous 🙏 pour nous aider à le lancer...

    👉 Je découvre le projet

    Quatre questions à explorer en 2022 :
    → Quels mystères nous cache encore la Lune 🌙 ?
    → Pourra-t-on bientôt tout guérir grâce aux gènes 👩‍⚕️?
    → Comment nourrir le monde sans le détruire 🌍 ?
    → L’intelligence artificielle peut-elle devenir vraiment intelligente 🤖 ?

Discussions similaires

  1. [Biologie Moléculaire] Protéine de fusion
    Par montreux_d dans le forum Biologie
    Réponses: 3
    Dernier message: 28/03/2011, 18h56
  2. [Biochimie] [Biochimie] besoin d'aide, invention d'une protéine
    Par s.riche dans le forum Biologie
    Réponses: 0
    Dernier message: 29/09/2010, 22h18
  3. [Biologie Cellulaire] Protéine de fusion fc
    Par pas_douée dans le forum Biologie
    Réponses: 4
    Dernier message: 14/10/2008, 20h51
  4. [Biologie Moléculaire] Protéine de fusion
    Par lauvizh dans le forum Biologie
    Réponses: 15
    Dernier message: 01/06/2008, 10h10
  5. Réponses: 11
    Dernier message: 22/10/2006, 15h05
Découvrez nos comparatifs produits sur le sport et la santé.