Répondre à la discussion
Affichage des résultats 1 à 6 sur 6

Représenter le génome

  1. #1

    Représenter le génome


    Pour un projet, je cherche à représenter, entre autres génomes, le génome humain, et celà en deux dimensions.

    J'aimerai savoir s'il est possible de le représenter d'une manière ou d'une autre comme une il est fait pour les molécules : molecule-cafeine-3.jpg

    Si cela n'est pas possible, quelles sont les autres possibilités, sachant que j'aimerai le plus possible éviter la projection d'une illustration 3D en 2D (comme cela : c'est MAL : Genome.png ou la représentation du ... le nom me manque : bref, de ca : c'est MAL aussi : Human-genome-001.jpg

    Merci de vos réponses


  2. Publicité
  3. #2

    Re : Représenter le génome


    Tu souhaite représenter le génome ou la molécule d'ADN? Parce que représenter le génome, ça risque d'être un peu compliqué...

    Par contre des représentations de la molécule d'ADN en 2D, ils en existe quelques unes, comme celle-ci par exemple.

    Ta dernière image représente une électrophorèse d'ADN mais j'avoue que je suis pas sur de la méthode utilisée.


  4. #3

    Re : Représenter le génome

    Merci de ta réponse, qui, outre le fait de montrer ma totale ignorance biologique, me fait envisager une option qui m'était particulièrement passée hors de perspective

    Concernant la molécule d'ADN, j'ai vu sur l'article en lien qu'il y a des représentations "a plat".
    Alors tout d'abord, je vais poser la question la plus stupide qui soit (et j'en ai honte), mais est-ce que l'ADN humain est comparable aux autres types d'ADN (y à t'il plusieurs types d'ADN ou un seul type d''ADN ? Je me souviens d'une expérience au lycée ou nous avions passé au mortier des feuilles de chou-fleur puis plongés dans un liquide (mais lequel ? bonne question), afin d'obtenir des filaments blancs remontant vers la surface, et, d'un argument d'autorité, le prof de bio nous avait asséné un "ceci, c'est de l'ADN").

    A ces conditions, est-il possible de représenter à plat (comme le montre le schéma de mon premier poste) une molécule d'ADN, ou , quelle est la plus petite partie représentable possible afin de "faire" un humain ?

    Question " : est-ce que cet ADN (ou tout du moins la représentation de sa molécule) est combinable avec une autre molécule d'ADN (exemple : du chou-fleur) ?

    Merci !
    Dernière modification par Federfleisch ; 30/07/2012 à 17h20.

  5. #4

    Re : Représenter le génome


    C'est parti pour un micro cours de biologie !

    L'ADN est un code universel commun à toutes les espèces vivantes. Chimiquement parlant, il est composé d'une double hélice de sucre, et le "code" constitué de 4 lettres correspondant à des molécules chimiques : A (adénine), T (Thymine), C (Cytosine) et G (Guanine). Ces molécules s'apparient deux à deux tous les longs de la double hélice. C'est l'ordre de ces lettres qui va permettre de décoder les gènes et de les exprimer.
    Après, selon les organismes, cet ADN va être présent sous forme d'un ou plusieurs chromosomes. Les chromosomes sont le stade d'extrême compaction de cette double hélice.

    Donc pour répondre à tes questions :
    - l'ADN est le même pour tous, mais il ne raconte pas la même histoire. (En gros, c'est comparable au code binaire qui permet aux ordinateurs de fonctionner, tous les ordinateurs ont le même, mais pas fichu pareil !)
    - Si tu approfondi tes recherches tu découvriras qu'il existe plusieurs sortes d'ADN, mais en fait, ce ne sont que des questions de formes d'hélice liées à la chimie
    - Ton premier schéma serait un nucléotide, qui compose l'ADN (donc une lettre !).

    Donc je serai toi, pour représenter l'ADN, je choisirai de mettre une double hélice, et/ou un caryotype. Sinon tu peux aussi mettre le "code" en lui même. Ca donne des choses assez barbares style "ATGTTTAGTAGCCCGTCATGACTAGCTAC GATTTAGCCCA..."

    Et pour le petit plus :
    - L'ADN est le support de l'information génétique. Les gènes sont exprimés à partir de l'ADN grâce au code génétique. Les gènes sont traduits en protéines, qui permettront leur expression, et par conséquent de ressembler à un humain, ou à un chou-fleur.

    PS : l'extrait d'ADN, c'était bel et bien de la chromatine, mais dans un état non exploitable pour la suite

  6. #5

    Re : Représenter le génome

    quelle est la plus petite partie représentable possible afin de "faire" un humain
    pour faire un humain, il faut tout le génome puisque c'est la position des bases (ATCG) dans la chaine qui déterminent la protéine, une petite partie n'est pas suffisante,
    Mais sinon oui tu peux représenter l'ADN (enfin un fragment) sous forme moléculaire (de la même façon que ta première image sur le premier message
    comme celui que t'a montré TanguyE

  7. A voir en vidéo sur Futura
  8. #6

    Re : Représenter le génome

    le plus simple serait peut être de savoir un peu quel est le but de cette représentation, ça pourrait aider.
    Représenter l'ADN humain par son code génétique, c'est aligner 3 milliards de lettre ATCG à la suite, même chose si tu représentes par les molécules.
    Donc si ton projet n'occupe pas un entrepôt entier (et encore), va falloir sortir le microscope pour regarder ta représentation. Représentée par des lettres d'1 mm de large, ça représente tout de même une longueur de 3000 km . Donc représenter complètement tout cela...
    De plus la représentation que tu n'aimes pas a l'avantage d'être connu de tous. Je pense que n'importe qui (ou presque) voyant une double hélice fait le rapprochement.
    Après tout dépend le but de cette présentation.

    Pour ta question sur l'extraction de l'ADN, c'était surement de l'éthanol (appelé communément alcool)

  9. Publicité

Sur le même thème :

Discussions similaires

  1. Représenter un Volume
    Par Mcflys dans le forum Mathématiques du supérieur
    Réponses: 3
    Dernier message: 19/01/2012, 21h57
  2. [Génétique] La différence entre le génome humain et le génome du chimpanzé
    Par thome dans le forum Biologie
    Réponses: 8
    Dernier message: 11/12/2009, 19h04
  3. Representer stéréoisomère
    Par b4d4ss dans le forum Chimie
    Réponses: 10
    Dernier message: 28/08/2009, 10h11
  4. Se représenter x² vect(ey) dans (ex,ey,ez).
    Par Elipiks dans le forum Mathématiques du collège et du lycée
    Réponses: 2
    Dernier message: 28/10/2008, 06h55
  5. se représenter 1/(-4)
    Par mater dans le forum Mathématiques du collège et du lycée
    Réponses: 7
    Dernier message: 09/11/2006, 23h16