Répondre à la discussion
Affichage des résultats 1 à 13 sur 13

definition exacte des genes et alleles



  1. #1
    omkar

    definition exacte des genes et alleles

    Je ne comprends pas la difference EXACTE entre le gene et l'allele . Et s'il vous plait je n veux pas des exemples comme les couleurs des yeux (noirs ou bleux ...). S'il vous plait je veux une definition exacte .. Par exemple : un gene est un fragment d'ADN .. Est ce qu'il est une sequence des nucleotides ?? Si oui .. Alors c'est quoi un allele ?? Les alleles sont crees par mutation du gene, mais si le gene n'est pas mute, pas d'alleles ?? La technique de FISH comment repere-t-elle un gene et pas un allele ??
    Merci beacoup pour vos explications.

    -----


  2. Publicité
  3. #2
    Htu

    Re : definition exacte des genes et alleles

    Salutations.

    Alors exemple très simple : La couleur des cheveux...! (Ça va, ça va... c'pas drôle)

    Donc, un gène est une séquence d'ADN (donc un enchaînement de nucléotides) qui code pour une chaîne polypeptidique ou un ARN fonctionnel.
    Donc sur le terrain, un gène c'est 5' - AGAGTAGATGCTCGCTCGAGCTATGAGCTA CGATTATGCGCTCTGATCTAGCTATCTTGA TCGCATCACG - 3'

    Une allèle est une VERSION d'un gène, ce qui signifie que c'est une séquence d'ADN semblable à celles des autres versions. Cependant, le peu de nucléotides qui changent feront que le gène codera pour une protéine qui sera fonctionnelle, avec le même rôle, mais pas forcément le même aspect. Tu me suis? C'est pour cela qu'on dit que c'est le même gène, mais une version différente.
    Ces différences apparaissent par des mutations.

    Ça va mieux, ou il faut plus de détails ou une explication autre?

  4. #3
    omkar

    Re : definition exacte des genes et alleles

    D'abord merci pour l'explication.
    Mais .. Le gene que tu as donne .. C'est pas un allele en meme temps ??
    La technique de Fish (en utlisant les sondes) qui repere les genes .. Comment elle repere les genes ?? C'est pas les alleles qu'elle repere ??
    S'il vous plait je veux une explication plus precise.
    Et je vous remercie.

  5. #4
    toothpick-charlie

    Re : definition exacte des genes et alleles

    Citation Envoyé par omkar Voir le message
    Mais .. Le gene que tu as donne .. C'est pas un allele en meme temps ??
    en fait les allèles d'un même gène sont des séquences très proches les unes des autres. Je crois que chez les humains il y a quelque-chose comme un polymorphisme toutes les 1000 paires de bases. Donc pour décrire un gène on donne la version (l'allèle) le plus répandu (il y en a en général un) ou bien peut-être le premier qui a été séquencé (mais ça risque d'être le même).

  6. #5
    omkar

    Re : definition exacte des genes et alleles

    toothpick-charlie

    ce que j'ai compris .. C'est que le gene est une sequence de nucleotides et cette sequence n'est precise .. Et ce qui differe un gene d'un est seulement son locus ??

  7. A voir en vidéo sur Futura
  8. #6
    Came31

    Re : definition exacte des genes et alleles

    En gros, un gène code pour un caractère donné.
    Ex : couleur des yeux.
    Donc, tous les êtres humains normalement constitués possèdent les mêmes gènes, c'est-à-dire le même "plan de structure".
    Pourtant nous sommes tous différents, et cela s'explique par le fait que nos gènes, bien qu'ils aient une fonction similaires, ne sont pas identiques. Ces différentes versions d'un gène sont appelées allèles. Deux alleles d'un même gène se trouvent sur deux chromosomes homologues différents et les emplacements qu'ils occupent se nomment "locus".
    En résumé, les individus d'une même espece ont les mêmes gènes, mais pas les mêmes allèles ce qui est à l'origine de la biodiversité. Et chaque individu possède dans son g

  9. Publicité
  10. #7
    Julienbio

    Re : definition exacte des genes et alleles

    En 2 mots: les allèles sont les différentes versions d'un gène.

  11. #8
    omkar

    Re : definition exacte des genes et alleles

    merci a tous .. Mais c'est pas ce que je veux ou je demande
    une question plus precise :
    Est-ce que le gene est une sequence de nucleotides bien determinees ??
    Ou bien une sequence qui n'est precise ni determinee et distingue seulement par sa place sur l'ADN ??
    Et la technique de FISH, que repere-t-elle et comment ??

  12. #9
    Amanuensis

    Re : definition exacte des genes et alleles

    Citation Envoyé par omkar Voir le message
    merci a tous .. Mais c'est pas ce que je veux ou je demande
    une question plus precise :
    Est-ce que le gene est une sequence de nucleotides bien determinees ??
    Ou bien une sequence qui n'est precise ni determinee et distingue seulement par sa place sur l'ADN ??
    Assez précise mais pas déterminée, en plus de la place dans le génome. Plus la fonction.

    Le mot gène couvre à la fois une fonction (et donc les aspects "principaux" de la séquence) et une position dans un génome (pour une espèce donnée). Un allèle est une "version" déterminée du gène, une séquence précise de nucléotides.

    Pour la place dans le génome on utilise le mot "locus".
    Pour toute question, il y a une réponse simple, évidente, et fausse.

  13. #10
    omkar

    Re : definition exacte des genes et alleles

    Amanuensis

    merci, j'ai compris un peu.
    Mais pouvez vous svp expliquer un peu plus "Assez précise mais pas déterminée" ??
    Mon probleme est dans la definition d'un gene et un allele et la difference entre le gene et l'allele au niveau de la sequence des nucleotides.
    Merci

  14. #11
    Cendres

    Re : definition exacte des genes et alleles

    Citation Envoyé par omkar Voir le message
    Et la technique de FISH, que repere-t-elle et comment ??
    Elle peut être utilisée sur de l'ADN, de l'ARN, des protéines, par fluorescence (ce sont des sondes moléculaires avec un marqueur fluorescent).

    Elle est par exemple utilisée pour détecter certaines maladies génétiques, comme le syndrome de Jacobsen ou celui de Williams, par repérage de micro-délétions. On peut aussi l'utiliser pour étudier la biodiversité. Cette technique est aussi appelée "hybridation in situ en fluorescence".
    N'a de convictions que celui qui n'a rien approfondi (Cioran)

  15. #12
    Cendres

    Re : definition exacte des genes et alleles

    Citation Envoyé par omkar Voir le message
    Mon probleme est dans la definition d'un gene et un allele et la difference entre le gene et l'allele au niveau de la sequence des nucleotides.
    Merci
    Les différents allèles d'un gène diffèrent un petit peu dans leur séquence nucléotidique; mais ils possèdent la même fonction, le même emplacement sur le même chromosome. C'est exactement comme si tu possédais plusieurs versions d'une traduction d'un texte, mais avec très peu de différences.
    N'a de convictions que celui qui n'a rien approfondi (Cioran)

  16. Publicité
  17. #13
    omkar

    Re : definition exacte des genes et alleles

    Cendres

    Merci pour votre explication.
    Mais a propos de la technique de FISH, je demande comment la faire au niveau du reperage d'un gene; c.a.d comment on la fait pour reperer un gene, puisque le gene est mute (la sequence nucleotidique est modifiee) ??
    Et a propos le gene, peut-n considerer un gene non mute un allele ??

Sur le même thème :

Discussions similaires

  1. gènes et allèles
    Par sihamoun dans le forum Biologie
    Réponses: 10
    Dernier message: 07/09/2012, 12h58
  2. [Génétique] Questions autour des chromosomes, allèles, gênes
    Par sjc42 dans le forum Biologie
    Réponses: 2
    Dernier message: 29/04/2012, 15h23
  3. La couleur de la peau,SVT 3ème, allèles,gènes...
    Par niafron dans le forum TPE / TIPE et autres travaux
    Réponses: 8
    Dernier message: 02/03/2012, 15h44
  4. chromosomes, genes et alleles
    Par homininee dans le forum Exercices en biologie
    Réponses: 3
    Dernier message: 23/10/2011, 19h38
  5. [Génétique] Les Allèles des gènes !
    Par Biob dans le forum Biologie
    Réponses: 10
    Dernier message: 20/09/2008, 18h02