Répondre à la discussion
Affichage des résultats 1 à 4 sur 4

Transformation du brin codant en séquence d'acides aminés.



  1. #1
    Betty96

    Transformation du brin codant en séquence d'acides aminés.

    Bonjour, je suis nouvelle sur ce forum, Les sciences n'est pas vraiment mon fort et j'ai pas mal des difficultés à l'école à cause de ça. Dans ce forum il y a eu des discussions qui m'ont bien aidé. Alors je suppose que vous pouvez m'aider à m'améliorer et à mieux comprendre les sciences.Je vais vous faire part d'un exercices qu'avant je ne comprenait rien, maintenant j'ai réussi à le faire mais je sais pas si je me suis trompé. Pouvez vous m'aider ? L'exercice est comme ça :

    1) L'ocytosine est une hormone favorisant les contractions de l'utérus, soit la séquence suivante du brin codant :

    ACGATGTAGGTCTTGACGGGGGACCCGACT

    Donnez la séquence d'acides aminés de l'ocytosine.
    Justifiez votre réponse en expliquant clairement votre démarche. Votre copie sera soignée. Vous vous exprimez dans un langage scientifique correct.

    (Ben ici il y avait un tableau montrant les acides aminés selon les 3 nucléotides, mais je sais pas comme le montre ici, tapez codegénétique. gift et vous le verrez, c'est celui qui dit "deuxième/première/troisième lettre")

    -Une mutation se produit et les nucléotides 7 à 10 sont perdus. Quelle sera la ou les conséquences de cette mutation?
    Justifiez votre réponse en expliquant votre raisonnement. Votre copie sera soignée. Vous vous exprimez dans un langage scientifique correct.

    Et maintenant ma réponse...

    Threonine - Méthionine - Codons Stop - Valine - Leucine - Threonine - Glycine - Acide Aspartique - Proline - Threonine

    La thymine ( T ) de l'ADN à été remplacé par l'uracile ( U ) dans l'ARNm. Le message de l'ARNm consiste en une série de codons, une suite de 3 nucléotides alignés sur la molécule de l'ARN et celui qui fait la traduction du brin codant en protéine est l'ARNt. Les molécules d'ARNt ne sont pas toutes identiques. Chaque sorte de molécule d'ARNt associe un certain codon d'ARNm avec un certain acide aminé, ce qui constitue la clé de traduction du message génétique en séquence d'acides aminés. J'ai utilisé le tableau donné pour construire la séquence d'acides aminés de l'ocytosine.

    - Les conséquences de cette mutation sont que le message d'origine est modifié, ce sont ces mutations qui créent des nouvelles formes alléliques des gènes. Elles alimentent la variété génétique de l'individu.

    Et voilà, c'était ma réponse, est ce que c'était juste ? Est ce que c'etait assez claire ? Dois je corriger quelque chose? Merci d'avance pour votre aide. J'attends vos réponses avec impatiente n.n

    -----


  2. #2
    Meiosis

    Re : Transformation du brin codant en séquence d'acides aminés.

    Salut,

    L'exercice manque, selon moi, cruellement de données.

    On te donne le brin codant mais il ne s'agit pas du brin codant...
    Par convention ce brin devrait être orienté 5' vers 3' mais ce n'est pas le cas, étant le brin transcrit (et après vérification avec la vraie séquence en acides aminés de l'ocytocine humaine).
    On te donne directement la séquence codante sans précision, il fallait le deviner, car au début je cherchais un AUG, en vain. D'ailleurs tu as eu raison de le faire, ce qui t'a perdu car je te confirme que ta séquence en acides aminés est fausse.

    Donc après recherche, il s'agit bien du brin transcrit donc non-codant, que l'on te donne. Ce dernier est orienté 3' vers 5' et la lecture commence ici "de gauche à droite", il y a un "TAC" juste avant le "ACG", ce qui donne finalement :

    3' TAC ACG ATG TAG GTC TTG ACG GGG GAC CCG ACT 5'

    Le vrai brin codant est :

    5' ATG TGC TAC ATC CAG AAC TGC CCC CTG GGC TGA 3'

    L'ARN polymérase 2 lit de 3' en 5' sur le brin transcrit, ce qui donne un ARNm orienté de 5' (extrémité N-terminale de la protéine) vers 3' (extrémité C-ter) :

    5' AUG UGC UAC AUC CAG AAC UGC CCC CUG GGC UGA 3'

    Qui est donc de même séquence que le brin codant aux T près (U à la place sur l'ARNm) et entièrement complémentaire au brin transcrit (= non codant).

    On recherche le premier codon stop, ici c'est UGA.

    La traduction commence à l'AUG qui code pour une méthionine.

    Autre défaut de l'exercice selon moi : pour cette protéine la première méthionine est clivée après la traduction, tu ne peux pas le deviner, ni moi.
    L'ocytocine a donc 9 acides aminés (car 9 codons).
    La séquence primaire de la protéine (enchaînement des acides aminés) est donc :

    N-ter Cystéine - Tyrosine - Isoleucine - Glutamine - Asparagine - Cystéine - Proline - Leucine - Glycine - (stop) C-ter

    Autre point dans ce type d'exercice : on croit toujours que la séquence d'ADN rend directement compte de la séquence de l'ARNm et donc de la séquence primaire de la protéine, ce n'est pas toujours le cas, à cause des introns et de l'épissage... En réalité soit on vire les introns (j'imagine qu'ils ont fait ça, personnellement je ne connais pas la structure du gène de l'ocytocine) pour ne garder que les exons, soit on prend un gène sans intron... Quelqu'un pourra sans doute nous éclaircir, mais c'était pour dire de faire attention à ça aussi, généralement on simplifie tout avec ce genre d'exercice.

    Pour la seconde question maintenant.

    Les nucléotides 7 à 10 sont perdus (mutation par délétion), j'imagine que c'est sans prendre en compte le TAC que j'ai ajouté moi pour y voir plus clair, donc on compte à partir du ACG.

    3' TAC ACG ATG TAG GTC TTG ACG GGG GAC CCG ACT 5'

    Les 4 nucléotides en gras sont donc perdus.
    La séquence du brin transcrit devient donc :

    3' TAC ACG ATG TCT TGA CGG GGG ACC CGA CT 5'

    Ce qui donne comme ARNm :

    5' AUG UGC UAC AGA ACU GCC CCC UGG GCU GA 3'

    En séquence primaire cela donne (la première méthionine est virée toujours) :

    N-ter Cystéine - Tyrosine - Arginine - Thréonine - Alanine - Proline - Tryptophane - Alanine

    Bref tu vois bien que les deux premiers acides aminés sont identiques à l'ocytocine mais comme après la mutation par délétion a effacé 4 nucléotides cela a changé le cadre de lecture du ribosome, donc les autres acides aminés sont différents et il n'y a plus de codon stop, au moins pour la partie de la séquence qu'on te donne, la protéine pourra être plus longue et différente, un codon stop sera rencontré plus loin...

    Elle sera sans doute non fonctionnelle, puisque cela perturbera sa structure secondaire et son repliement dans une structure tertiaire viable.

    Par contre c'est bizarre, quand ils disent "les nucléotides 7 à 10" je pense plutôt qu'ils veulent dire "juste enlever 3 nucléotides, soit TAG et non TAGG, si tel est le cas alors il y aurait juste un codon qui sauterait avec conservation du codon stop, il y aurait juste disparition de l'isoleucine, ce qui semble plus logique pour ce type d'exercice. Enfin si tu as le raisonnement c'est le principal.

    Pour en venir, finalement (ouf) à ta réponse :

    La thymine ( T ) de l'ADN à été remplacé par l'uracile ( U ) dans l'ARNm. Le message de l'ARNm consiste en une série de codons, une suite de 3 nucléotides alignés sur la molécule de l'ARN et celui qui fait la traduction du brin codant en protéine est l'ARNt. Les molécules d'ARNt ne sont pas toutes identiques. Chaque sorte de molécule d'ARNt associe un certain codon d'ARNm avec un certain acide aminé, ce qui constitue la clé de traduction du message génétique en séquence d'acides aminés. J'ai utilisé le tableau donné pour construire la séquence d'acides aminés de l'ocytosine.
    Attention le brin codant n'est pas traduit, c'est l'ARNm qui l'est.
    Ensuite l'ARNt participe au phénomène de traduction mais ce n'est pas le seul, ce sont surtout les ribosomes. L'ARNt vient se fixer au site P du ribosome et reconnaît le premier codon AUG d'initiation de la traduction via son anticodon 3' UAC 5'. Un deuxième ARNt, via son anticodon reconnaît le deuxième codon adjacent à l'AUG et apporte son acide aminé greffé sur l'extrémité 3' de l'ARNt, la liaison peptidique se fait entre les deux acides aminés, il y a translocation et le premier ARNt va dans le site E pour partir, le deuxième devient le premier et passe dans le site P, etc de proche en proche jusqu'au codon stop.

    Voilà pour ma réponse, détaillée (peut-être beaucoup trop) mais au moins j'espère que tu comprendras le principe et ce qui n'allait pas.

    Si tu as des questions n'hésite pas, c'est un point toujours délicat en biologie moléculaire.

  3. #3
    Betty96

    Re : Transformation du brin codant en séquence d'acides aminés.

    Merci pour ta réponse Meiosis, j'ai relu et relu ton explication mais je n'arrive pas à comprendre complètement. Comment est ce qu'on peut savoir si c'est la séquence du brin codant ou le brin no codant ? Pour quoi la prof note "brin codant " si en réalité c'est brin no codant? Comment suis je supposée diviner ça ? Tu veux dire quoi en disant d'être orienté de 3' vers 5' ou 5' vers 3' ? Le TAC il sort d'où ? C'est une règle de le mettre toujours devant la séquence ? Ou c'est seulement dans cette exercice ? Je dois dire que je suis bien perdue, cette exercice à été donné dans mon examen de juin... et j'ai le raté... maintenant j'étudie pour le rattrapage en septembre mais si la prof met des exercices où on doit carrément diviner des infos je suis mal barrée... Pourrais tu m'éclaircir s'il te plaît ?

  4. #4
    Loupsio

    Re : Transformation du brin codant en séquence d'acides aminés.

    Comment est ce qu'on peut savoir si c'est la séquence du brin codant ou le brin no codant ?
    Tu ne peux pas,
    encore moins avec le peu d'info qui t'es donné, pour le savoir il faut avoir la séquence complete, avec le promotteur et tout,
    en controle si elle te dit que c'est le brin codant, tu considère que c'est le brin codant, même si dans la réalité elle s'est trompé, de toute facon tu ne le sauras pas

    Tu veux dire quoi en disant d'être orienté de 3' vers 5' ou 5' vers 3' ?
    l'orientation est un principe de génétique, vu que : ATC est different de CTA par exemple, il faut l'orienter, c'est a dire situer le debut et la fin,
    la polymerase va dans le sens 5' vers 3',
    si on considere que la polymerase arrive en plein milieu de la sequence
    5'-AAAAAAAAAACCCCCCCCCCC-3'
    Elle se dirigera vers les cytosine
    si en revanche on a :
    3'-AAAAAAAAAACCCCCCCCCCC-5'
    et qu'elle se fixe en plein milieu de la sequence, ce coup ci elle ira vers les Adenines car :
    3'-AAAAAAAAAACCCCCCCCCCC-5'
    c'est en réalité la meme chose que
    5'-CCCCCCCCCCAAAAAAAAAAA-3'

    Le TAC il sort d'où ?
    Le TAC c'est le codon initiateur, car une fois transcris en ARNm ce sera AUC et AUC est le codon initiateur,
    elle le sort du fait qu'elle a recherché la vraie séquence, sinon en controle tu ne peux pas le savoir,
    le fait est que la traduction ne peut pas commencer sans ce codon donc il est important, mais votre prof l'a ignoré et vous a fait commencé directement après ce codon
    mais techniquement si on te donne une sequence tu n'est pas censé commencer a "traduire" tout ce qu'il y a avant ce codon car la traduction commence au codon, mais ta prof a retiré tout ce qui était avant la sequence traduite (tout le non traduit plus le codon d'initiation)

Sur le même thème :

Discussions similaires

  1. Séquence Acides aminés
    Par Ketsuu dans le forum Chimie
    Réponses: 1
    Dernier message: 17/03/2015, 17h26
  2. [Pré-BAC] [1ereS] Trouver une sequence d'acide aminee et le brin codant
    Par pierredelyon dans le forum Exercices en biologie
    Réponses: 2
    Dernier message: 19/02/2010, 18h13
  3. [Biochimie] determination de la sequence en acides aminés
    Par hanaeuh dans le forum Biologie
    Réponses: 4
    Dernier message: 04/11/2007, 11h25
  4. séquence en acides aminés
    Par vachalait dans le forum Biologie
    Réponses: 5
    Dernier message: 02/02/2007, 21h15