Répondre à la discussion
Affichage des résultats 1 à 8 sur 8

métagénomique, bio informatique et electrophorese DGGE



  1. #1
    cocostage

    métagénomique, bio informatique et electrophorese DGGE


    ------

    Bonjour à tous,

    je suis actuellement en stage dans un laboratoire faisant des études sur le sol et j'ai un petit problème.
    Je m'explique.. Nous avons réalisé une PCR sur nos échantillons de terre avec des amorces trouvé dans une revu scientifique correspondant en tout point à notre sujet, le problème étant qu'en attendant de pouvoir faire la DGGE ma maitre de stage m'a demandé de vérifier grace au site du NCBI et en faisant un blast que les séquences d'amorce matchaient bien avec les séquence ARNr 16s de bactérie présente généralement dans le sable et suceptible de sortir lors de la DGGE et d'en déduire leur taille. Cependant aucune ne matche correctement.
    Le problème viens-t-il de ma mauvaise maitrise du blast ou bien du choix des amorces ?

    amorce fwd : AACGCGAAGAACCTTAC
    amorce reverse : GCCACACATGTTCTGGGCCCTTGC

    et les bactéries que l'on trouve générallement dans le sol sont du genre : pseudomonas, rhizobium, azotobacter, nitrobacter, streptomyces


    merci beaucoup d'avance si quelqu'un arrive à me sauver !!!!

    -----

  2. Publicité
  3. #2
    Flyingbike

    Re : métagénomique, bio informatique et electrophorese DGGE

    C'est censé être quoi ces amorces ?
    La vie trouve toujours un chemin

  4. #3
    cocostage

    Re : métagénomique, bio informatique et electrophorese DGGE

    ces amorces sont censé se positionner sur l'adn extrait du sol que l'on étudie lors de la pcr afin d'amplifier une partie du gène, cette partie amplifier va alors subir une dgge qui va nous permettre de séparer les differentes bactéries pésente dans chaque échantillon de sol...
    C'est ce que j'en ai compris en tout cas

  5. #4
    Flyingbike

    Re : métagénomique, bio informatique et electrophorese DGGE

    Du 16s ? C'est dans des parties constantes ?
    La vie trouve toujours un chemin

  6. #5
    cocostage

    Re : métagénomique, bio informatique et electrophorese DGGE

    non, 16s est une région variable. c'est une région spé aux bactéries

  7. A voir en vidéo sur Futura
  8. #6
    Flyingbike

    Re : métagénomique, bio informatique et electrophorese DGGE

    Ce que vous amplifiez est variable, j'ai bien compris, mais vos amorces sont dans des parties conservées ? Sinon je ne vois pas l'intérêt...
    La vie trouve toujours un chemin

  9. Publicité
  10. #7
    cocostage

    Re : métagénomique, bio informatique et electrophorese DGGE

    oui oui.

    Je viens de blaster à nouveau mes amorces contre des séquences de bacteries et je les ai enfin trouvé ! Mais j'ai toujours un problème car maintenant que ça onctionne je ne comprends pas pourquoi. En effet pour trouver un résultat cohérent j'ai mis les deux amorces dans le sens 5'-3'. Or de ce que j'avais compris l'amorce reverse aurait du être complémentaire (mais ça ne marche pas quand je le blaste en complémentaire.)

    5'-------------------------------------3'
    <---- rev
    ---->fwd
    3'-------------------------------------5'

    Auriez vous un reseignement ? Suis-je passé à coté de quelque chose ?

  11. #8
    Flyingbike

    Re : métagénomique, bio informatique et electrophorese DGGE

    On met toujours les amorces en 5' 3' par convention

    le blast trouve ce qui correspond , c'est a dire ce qui est amplifié entre l'amorce F 5' 3' et la reverse 5' 3' mais sur le brin complémentaire (équivalent au reverse complement sur le brin direct)


    on trouve des trucs du genre (avec des mismatch) mais pas dans les organismes dont vous parlez...


    Nouvelle image bitmap.jpg
    La vie trouve toujours un chemin

Sur le même thème :

Discussions similaires

  1. Exploitation des gels DGGE
    Par wolfheart973 dans le forum Biologie
    Réponses: 1
    Dernier message: 10/09/2012, 20h29
  2. Approche métagénomique ?
    Par Iforire dans le forum Biologie
    Réponses: 5
    Dernier message: 27/01/2009, 16h28
  3. [Biologie Moléculaire] DGGE et problème de polymérisation
    Par maïty dans le forum Biologie
    Réponses: 0
    Dernier message: 24/01/2008, 09h35
  4. aide pour un protocole (PCR, DGGE...)
    Par Henson dans le forum Biologie
    Réponses: 13
    Dernier message: 25/05/2007, 20h56
  5. Pcr - Dgge
    Par mol-R dans le forum Biologie
    Réponses: 3
    Dernier message: 19/03/2006, 07h22