Répondre à la discussion
Affichage des résultats 1 à 2 sur 2

Acide nucléiques



  1. #1
    samantha_renaever

    Acide nucléiques


    ------

    Bonjour j'ai besoin de votre aide pour cet exercice svp

    1) comment nomme-t-on l'assemblage d'une base azotée et d'un glucide ?
    2) L'acide nucléique est un assemblage de .......................
    3) soit le polynucléotide suivant:

    5' AUGACUUGUCACAUCUA GACUCACUAG 3'

    Mis dans un système acellulaire approprié il permet la synthèse du peptide suivant qui est libéré es ribosomes:


    méthionyl-thréonyl-cystéinyl-histidinyl-isoleucine


    justifier la composition de ce peptide ?


    4) une mutation ayant transformé le G espacé en C quel peptide est alors synthétisé et libéré dans le milieu ?

    5) Transcription et traduction

    La séquence suivante représente la séquence des bases du brin d'ADN complémentaire au brin matrice.

    5' TGCACGATGTTAGGTACGCCAGAGTATAGT GCTGTATAGCCGAGGCGA 3'


    Donner la séquence de l'Arn messager.


    Trouver la séquence des acides aminés de la protéine codée.

    -----

  2. #2
    moco

    Re : Acide nucléiques

    Le Forum n'est pas une machine gratuite pour faire le travail à ta place. Il est là pour aider ceux qui essaient de faire quelque chose, et qui crochent à un certain moment. Nous les aidons à franchir la passe difficile. Mais nous ne sommes pas là pour faire tout, et toi rien. Alors essaie de faire quelque chose. Par ailleurs, il me semble que ta demande est plus du ressort de la biologie que de la chimie, domaine de ce Forum.

Sur le même thème :

Discussions similaires

  1. [Licence (L1-L2-L3)] manipulation des acides nucleiques
    Par luger11 dans le forum Exercices en biologie
    Réponses: 1
    Dernier message: 12/04/2011, 10h07
  2. [Microbiologie] Archéobactérie et acides nucléiques.
    Par goubixx dans le forum Biologie
    Réponses: 20
    Dernier message: 12/01/2011, 18h22
  3. [Biochimie] sondes nucléiques
    Par lorino dans le forum Biologie
    Réponses: 0
    Dernier message: 22/02/2010, 17h27
  4. [Biochimie] exercice sur les acides nucléiques
    Par Cedricle100 dans le forum Biologie
    Réponses: 2
    Dernier message: 30/04/2009, 13h45
  5. Manipulation des acides nucléiques
    Par Djelaba dans le forum Biologie
    Réponses: 7
    Dernier message: 02/02/2006, 21h18