Répondre à la discussion
Page 2 sur 2 PremièrePremière 2
Affichage des résultats 31 à 47 sur 47

Délai d'incubation Covid 19 avant un test PCR



  1. #31
    FabiFlam

    Re : Délai d'incubation Covid 19 avant un test PCR


    ------

    Citation Envoyé par Nine14140 Voir le message

    Mais il me reste le terme "amplification" à comprendre.
    Si je peux l'expliciter un peu avec mes faibles compétences sur le sujet: la technique polymerase chain reaction consiste à détecter la présence de séquences en les amplifiant spécifiquement en comparaison d'autres séquences également présentes qui elles ne seront pas amplifiées. Pour cela l'appareil en fait des "copies" et le nombre de "copies" à partir duquel la présence de cette séquence est considéré comme effective est le point crucial de la méthode, car en réitérant l'opération plusieurs fois (cycles d'amplification) on augmente la probabilité de détection mais également celle d'erreur de détection. Il y a donc un compromis à trouver.

    J'espère n'avoir pas écrit trop de bêtises.

    FabiFlam

    -----

  2. Publicité
  3. #32
    Flyingbike
    Modérateur

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Nine14140 Voir le message

    Alors pour ce test PCR.
    OK, je vois bien qu'on a des séquences de référence.
    Je suppose donc que l'objectif final est de chercher à savoir si la ou les séquences de référence se trouvent ou non dans l'échantillon.
    Exact. Il y a aussi des variantes, qui permettent de déterminer la quantité présente dans l'échantillon, de détecter des variants, des mutations, etc.

    Si c'est cela, j'appellerai cela de la détection.
    "Détecter si on retrouve des séquences d'adn données dans l'échantillon"
    Non ?
    Oui et non. En fait, le principe de la PCR, c'est d'amplifier, et pas de détecter. Sauf que pour détecter une séquence très particulière d'ADN (ou d'ARN d'ailleurs puisque le SARS-CoV2 est à ARN), les techniques historiques utilisant des sondes radioactives sont à la fois longues, complexes, chères, nécessitant de grandes quantités de matériel initial, et ont une sensibilité médiocre.
    La PCR permet, en choisissant judicieusement ses amorces, d'amplifier une séquence particulière d'ADN et seulement elle, au point qu'elle devienne détectable parmi le mélange très complexe d'acides nucléiques présents dans l'échantillon.


    Et je suppose que si dans l'échantillon, on retrouve un milliards de fois la séquence de référence, on pourra créer au maximum 1 milliard de séquence ADN dans le produit final appelé produit amplifié.
    Est-ce cela ou je n'ai pas encore tt compris ?
    .
    .

    ce n'est pas ça. Vous avez peut être appris que l'ADN est une molécule composée de nucléotides (A,T, G ou C) dont l'enchainement constitue l'information génétique. Vous savez aussi peut être que l'ADN est la plupart du temps sous forme double brin, ou les brins sont appariés de façon complémentaire de telle sorte qu'un A est apparié à un T, et qu'un G est apparié à un C.

    Comme la :

    Code:
     
    atcgatcgtatgacttagct
    tagctagcatactgaatcga
    Vous avez peut être appris que lorsqu'une cellule se divise en deux cellules filles, elles contiennent chacune une copie du génome de l'hôte. Au préalable, ce génome a donc été dupliqué, et ce processus est réalisé dans la nature et pour tout organisme vivant par des enzymes qui sont capables, à partir d'un brin d'ADN, de remettre en face des nucléotides le nucléotide complémentaire. C'est comme cela que nos cellules ont toutes le même matériel génétique, répliqué avant chaque division.
    C'est ce principe la qu'on utilise dans la PCR, à la différence que ne souhaitant pas tout répliquer, on utilise des amorces spécifiques pour "limiter" le champ d'action de ces enzymes, qui se borneront donc à répliquer la séquence que l'on a ciblée. Autre différence, on ne se contente pas de "doubler" l'information pour avoir une copie, mais en réalisant des cycles (on peut y revenir sur la partie technique si vous souhaitez), on peut amplifier, à chaque cycle, les séquences d'intérêt du cycle précédent, et donc de façon exponentielle notre séquence cible (doublement à chaque cycle)

    Typiquement, une PCR classique de laboratoire permet d'obtenir de l'ordre de 2^30 copies. Assez pour que la détection (visualisation sur un gel, par exemple, ou dans le cas du Covid, émission d'un signal fluorescent (c'est le rôle de la fameuse "sonde" mentionnée plus haut, on peut y revenir si vous souhaitez) soit aisée. Assez pour détecter, en théorie, une seule molécule d'ADN dans un échantillon.


    Comme cela a été expliqué par FabiFlam, au bout d'un certain nombre de cycles, on peut obtenir un signal aspécifique, ou du moins, on considère que si on avait eu une cible à détecter, on aurait du la détecter. C'est pour cela que les résultats sont donnés sous la forme d'un "Ct", (cycle threshold), qui est en fait le nombre de cycles qu'on a du réaliser pour que le signal dépasse le seuil qu'on a défini.
    Dernière modification par Flyingbike ; 10/04/2021 à 08h42.
    La vie trouve toujours un chemin

  4. #33
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    J'ai trouvé une vidéo qui expliquerait assez bien.
    https://www.youtube.com/watch?v=-DuZh7I7f_I

    Si j'ai compris.
    Pour notre RT-PCR Quantitative fluo choisi pour identifier le sars-cov2
    1. Etape 1
      Création d'un brin d'ADN comportant les 2 amorces aux 2 extrémités et éventuellement la sonde qqe part dans la séquence. Ce brin s’assemble donc en partant d’un seul ADN issu de l’échantillon, de 2 amorces et éventuellement de la sonde fluorescente.
      Alors, si je dis que cette étape ne sélectionne qu'un brin d'ADN parmi les milliards de brins d'ADN de l'échantillon, ai-je bien compris ???
    2. Etape 2
      Multiplication de ce brin d'Adn obtenu dans l'étape 1;
      Doublement du nombre de brins à chaque cycle
      Donc, en fonction du n° de cycle en cours, le nombre de brins est égal à 2 puissance "nb cycles".
      On s'arrête lorsqu'on considère qu'on peut affirmer que dans les brins multipliés la sonde est présente ou non.
      Et dans le cas du sars-cov2, les sondes sont fluorescentes.
      Donc si la couleur fluorescente apparaît après le nombre de cycle nécessaire, le sars-cov2 est considéré faisant parti de l'échantillon.
    Que pensez-vous de tt cela ?

    PS : je fais aussi cette recherche suite aux affirmations des médias que le test PCR n'est pas fiable.
    Qu'il y a une majorité de faux positifs.
    Pourquoi les médias affirment-ils cela ?
    .
    PS2 : oui, je connais l'ADN, l'ARN, les bases, A, C, G et T, les ribosomes, etc .
    Mais, je n'ai pas forcement la maîtrise des termes techniques.
    .
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  5. #34
    FabiFlam

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Nine14140 Voir le message
    PS : je fais aussi cette recherche suite aux affirmations des médias que le test PCR n'est pas fiable.
    Qu'il y a une majorité de faux positifs.
    Pourquoi les médias affirment-ils cela ?
    .
    En biologie j'ai très peu de compétences mais en statistiques je me débrouille.

    Le problème c'est que plus l'incidence de l'infection est faible, plus le poids des faux positifs sera élevé.

    Je m'explique: supposons que le test donne 1 faux positif sur 1000 soit tout de même une spécificité de 99,9% et que l'incidence de l'infection dans la population soit de 1 personne sur 1000.

    Si vous testez 10000 personnes au hasard, vous pouvez vous attendre à un nombre de faux positifs de l'ordre de 10 et aussi à trouver 10 détections exactes de l'infection. Donc le test s'il est positif ne donne la bonne réponse qu'une fois sur 2, ce qui est très peu !

    C'est pourquoi la plupart du temps, le test n'est recommandé qu'en cas de symptômes ou si on est cas contact, car alors le poids des faux positifs en comparaison du nombre de détections exactes baisse.

    FabiFlam
    Dernière modification par FabiFlam ; 10/04/2021 à 16h58.

  6. #35
    Flyingbike
    Modérateur

    Re : Délai d'incubation Covid 19 avant un test PCR

    Les média qui affirment que les tests ne sont pas fiables et qu'il y a une majorité de faux positifs ne sont pas recommandables. De la news poubelle quoi....
    La vie trouve toujours un chemin

  7. #36
    MissJenny

    Re : Délai d'incubation Covid 19 avant un test PCR

    Effectivement c'est une qPCR qui est faite. Donc à chaque cycle on mesure un signal de fluorescence qui est proportionnel à la quantité d'ADN amplifié, et on trace la courbe de la quantité d'ADN en fonction du nombre de cycles. C'est une méthode plus fine que la méthode classique où on commence par un certain nombre de cycles, puis on fait une électrophorèse pour vérifier qu'on a amplifié des séquences de la bonne longueur (et dans mon ancien labo on envoyait à séquencer les produits de PCR pour être certains de ne pas avoir détecté un organisme proche de celui qui était recherché).

  8. Publicité
  9. #37
    FabiFlam

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Flyingbike Voir le message
    Les média qui affirment que les tests ne sont pas fiables et qu'il y a une majorité de faux positifs ne sont pas recommandables. De la news poubelle quoi....
    Ils n'y comprennent rien ... même avec des tests hyperfiables on peut avoir un nombre de faux positifs problématiques si on utilise les tests n'importe comment ...

    FabiFlam

  10. #38
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Voilà une autre vidéo.
    Le PCR Temps Réel démarre au chrono 52.
    https://www.youtube.com/watch?v=QVeVIM1yRMU
    .
    Plus je me renseigne, moins je comprends.
    Ou plutôt, plus j'ai de nouvelles questions.

    Par exemple, dans la vidéo précédente (https://www.youtube.com/watch?v=-DuZh7I7f_I),
    au chrono 1'00, on nous parle du mélange réactionnel et on nous dit qu'il faut commencer par faire un mélange à température ambiante de pleins de composants
    - de l'ADN polymérase
    - un tampon sous forme de sel de magnésium
    - les bases A, C, G, T
    - les fameuses SEQUENCES amorces et les séquence sondes fluo
    - la matrice ADN (je suppose que ce sont les cellules de l'échantillon prélevé sur la personne testée)

    Ensuite pour la première dénaturation, on chauffe à 95°.
    Pour l'hybridation, la T° est redescendue à entre 55 à 65°
    Ensuite, pour la polymérase, on remonte à 72°.

    Dans la 2 ième vidéo, il est dit qu'il faut 3 cycles de cette nature pour obtenir les amplicons, les ADN qu'on veut dupliquer, .

    Vous voyez, à ce point, je ne comprends pas pourquoi la totalité de l'ADN prélevé n'a pas subi la polymérase.
    Et pourquoi on ne peut pas vérifier alors que l'adn prélevé contient ou non les 3 "séquences référence" : les 2 amorces et la sonde.
    .
    PS : merci de ne plus utiliser le terme 'comp -- lot -- iste" quand des personnes se posent des questions.
    Ca fait vraiment bizarre d'entendre ça sur un site scientifique.
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  11. #39
    MissJenny

    Re : Délai d'incubation Covid 19 avant un test PCR

    Les températures ne sont pas toujours les mêmes, ça dépend des amorces notamment. Il y a une plus ou moins longue phase de mise au point qui sert justement à trouver les températures et les durées optimales. De même pour l'extraction de l'ADN il faut optimiser les différentes manipulations. Le principe de la PCR est simple mais la mise en oeuvre demande pas mal d'expérience.

  12. #40
    obi76
    Modérateur*

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Nine14140 Voir le message
    PS : merci de ne plus utiliser le terme 'comp -- lot -- iste" quand des personnes se posent des questions.
    C'est devenu malheureusement une habitude tellement c'est fréquent. Et encore pas plus tard que cette semaine, un autre intervenant nous a dit exactement la même chose, et clairement, on s'est aperçu après coup que c'était le message qu'il voulait faire passer. Du coup mieux vaut prévenir que guérir...

    Mais bon les choses étant claires je ne vois pas de problème...
    Dernière modification par obi76 ; 11/04/2021 à 11h28.
    Paradoxalement, ce sont les débats stériles qui se reproduisent le plus.

  13. #41
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par MissJenny Voir le message
    Les températures ne sont pas toujours les mêmes, ça dépend des amorces notamment.
    Merci.

    Vous voyez, dans mon questionnement, ce qui me semble le + délicat, c'est le choix des 2 amorces et surtout de la sonde.
    Puisque la sonde est fluo et que le résultat du test se base sur le fait que le mélange final soit fluorescent.
    .
    Voyez-vous. C'est là que je vois le + grand risque d'erreur.
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  14. #42
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    .
    J'avais écrit : "PS : merci de ne plus utiliser le terme 'comp -- lot -- iste" quand des personnes se posent des questions."
    -----------------------------

    Vous avez répondu :
    Citation Envoyé par obi76 Voir le message
    C'est devenu malheureusement une habitude tellement c'est fréquent. ...
    Je ne suis pas sûr de bien comprendre votre réponse.

    Voulez vous nous dire que :
    1) C'est une habitude que bcp d'intervenants parlent de choses qui concernent les problèmes actuels dans le monde; et qu'il ne faudrait pas que ces intervenants le fassent

    ou bien

    2) Dès qu'un intervenant parle de choses autour de la santé, de la pandémie, des vaccins, des tests, de la pandémie, ..., il y a toujours quelqu'un pour écrire "complotiste" alors que ce ne sont que de simples interrogations ou informations sur le sujet ?
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  15. Publicité
  16. #43
    obi76
    Modérateur*

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Nine14140 Voir le message
    1) C'est une habitude que bcp d'intervenants parlent de choses qui concernent les problèmes actuels dans le monde; et qu'il ne faudrait pas que ces intervenants le fassent
    2) Dès qu'un intervenant parle de choses autour de la santé, de la pandémie, des vaccins, des tests, de la pandémie, ..., il y a toujours quelqu'un pour écrire "complotiste" alors que ce ne sont que de simples interrogations ou informations sur le sujet ?
    3) c'est une habitude que des intervenants parlant de choses qui concernent les problèmes actuels dans le monde ne sont là que pour tenter de faire passer des propos complotistes, et pas pour discuter et/ou se renseigner.
    Paradoxalement, ce sont les débats stériles qui se reproduisent le plus.

  17. #44
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par obi76 Voir le message
    3) c'est une habitude que des intervenants parlant de choses qui concernent les problèmes actuels dans le monde ne sont là que pour tenter de faire passer des propos complotistes, et pas pour discuter et/ou se renseigner.
    Oui.
    Mais alors comment faire le tri ?
    Entre ceux qui cherchent des informations ?
    Et ceux qui viennent pour dénoncer les complots ?
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  18. #45
    obi76
    Modérateur*

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Nine14140 Voir le message
    Mais alors comment faire le tri ?
    Entre ceux qui cherchent des informations ?
    Et ceux qui viennent pour dénoncer les complots ?
    On fait le tri une fois que c'est avéré, mais en attendant on reste méfiant, c'est tout (d'où le message 24).
    Dernière modification par obi76 ; 12/04/2021 à 10h02.
    Paradoxalement, ce sont les débats stériles qui se reproduisent le plus.

  19. #46
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par obi76 Voir le message
    On fait le tri une fois que c'est avéré, mais en attendant on reste méfiant, c'est tout (d'où le message 24).
    Merci.
    Nous comprenons.

    Pouvons-nous alors vous demander :
    1) de ne pas sortir le mot "com --- p ----lot ---- iste" sur le forum
    2) nous l'indiquer en privé si quelque chose va dans ce sens.

    Merci d'avance.
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  20. #47
    obi76
    Modérateur*

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Nine14140 Voir le message
    1) de ne pas sortir le mot "com --- p ----lot ---- iste" sur le forum
    Pourquoi ? Appelons un chat un chat.

    Citation Envoyé par Nine14140 Voir le message
    2) nous l'indiquer en privé si quelque chose va dans ce sens.
    C'est ce que l'on fait déjà.

    Bref, fin du HS.
    Paradoxalement, ce sont les débats stériles qui se reproduisent le plus.

Page 2 sur 2 PremièrePremière 2

Discussions similaires

  1. QR - Dépistage de la Covid-19 : qu'est-ce que le test PCR ?
    Par RSSBot dans le forum Covid-19, SARS-CoV2 : actualités et discussions
    Réponses: 2
    Dernier message: 07/04/2021, 16h32
  2. QR - Dépistage de la Covid-19 : qu'est-ce que le test PCR ?
    Par RSSBot dans le forum Définitions et Questions / Réponses
    Réponses: 0
    Dernier message: 15/09/2020, 10h40
  3. Delai résultat covid au laboratoire
    Par 24061990 dans le forum Santé et médecine générale
    Réponses: 4
    Dernier message: 25/08/2020, 10h37
  4. Délai d'exposition de la paille avant pose de l'enduit
    Par trinle66 dans le forum Habitat bioclimatique, isolation et chauffage
    Réponses: 3
    Dernier message: 05/09/2011, 16h47
  5. Delai test
    Par choupine04 dans le forum MST : SIDA, syphilis, hépatite...
    Réponses: 1
    Dernier message: 06/06/2010, 21h43