Répondre à la discussion
Page 1 sur 2 1 DernièreDernière
Affichage des résultats 1 à 30 sur 47

Délai d'incubation Covid 19 avant un test PCR



  1. #1
    sunlounger

    Délai d'incubation Covid 19 avant un test PCR


    ------

    Bonsoir,

    à l'approche des fêtes de fin d'année, je me pose une question et mes recherches sont vaines à ce sujet :

    Combien de temps est il nécessaire entre le moment précis ou on "attrape" le Sars Cov 2 et le moment ou un test PCR permettra de le détecter ?

    Est-il le même que le temps d'incubation moyen (entre 3 et 5 jours) ou peut il se détecter avant ?

    Merci d'avance pour votre aide !

    -----

  2. Publicité
  3. #2
    Yann94600

    Re : Délai d'incubation Covid 19 avant un test PCR

    Ce qui est sûr est qu'il reste actif une semaine, mais je ne connais pas le délais d'activation.

  4. #3
    GBo

    Re : Délai d'incubation Covid 19 avant un test PCR

    Bonjour,
    Ce graphique montre que le peak d'ARN viral dans le pif (et donc la plus grande proba d'être positif au PCR), c'est quand les symptômes commencent à apparaitre (sauf dans les cas d'infectés dit "asymptomatiques" bien sûr, et c'est là tout l'intérêt du test à mon humble avis):

    Source: https://www.medmastery.com/guide/cov...rt-pcr-results

    Disclaimer : ce que je raconte là est à confirmer par un médecin ou biologiste qui passerait par là, je n'en suis pas (aucun diplôme en ce domaine, cyborg pas taper).

  5. #4
    sunlounger

    Re : Délai d'incubation Covid 19 avant un test PCR

    Merci pour ce graphique très clair. On voit en effet que le covid commence à se détecter au bout de 3-4 jours et que le maximum a lieu vers une semaine/une semaine et demi.

    Du coup peut on également conclure (grosso merdo) que la courbe de contagiosité suit la même courbe de détection ?

  6. A voir en vidéo sur Futura
  7. #5
    magura

    Re : Délai d'incubation Covid 19 avant un test PCR

    Bonsoir, la réponse est non. En moyenne, même si la RT-PCR reste positive (pour des fragments d'ARN viral), le virus n'est plus "cultivable" 9 jours après les premiers symptômes [la RT-PCR peut rester positive pendant plusieurs semaines]. Cela signifie qu'il n'y a plus de contagiosité. Cela explique la quarantaine réduite à moins de 14 jours. Bien à vous.

  8. #6
    sunlounger

    Re : Délai d'incubation Covid 19 avant un test PCR

    Avec bcp de retard merci pour votre réponse (je ne m'étais pas reconnecté depuis)

  9. Publicité
  10. #7
    papy-alain

    Re : Délai d'incubation Covid 19 avant un test PCR

    Je me souviens d'une étude chinoise qui montrait que la période de plus forte contagiosité se situait durant l'incubation, puis commençait à diminuer à l'apparition des symptômes, pour devenir évanescente au bout d'une semaine.
    Les météorites ne peuvent exister car il n'y a pas de pierres dans le ciel. Lavoisier.

  11. #8
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Bonjour,
    Je tente de comprendre ce qu'est ce test PCR.
    Je trouve partout qu'il a surtout comme fonction de multiplier les brins d'ADN pour pouvoir les analyser, pour avoir assez de matière..
    Mais une fois qu'on a multiplié l'ADN, qu'en fait-on ?

    Quelle est la chose à faire pour savoir qu'on a ou non été infecté par le virus ? (en labo bien sûr).

    Ai-je à peu près compris ou suis-je à côté de la plaque ?
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  12. #9
    MissJenny

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Nine14140 Voir le message
    Mais une fois qu'on a multiplié l'ADN, qu'en fait-on ?
    pour un simple test de détection du virus, on n'en fait rien. On se contente de vérifier que de l'ADN a été amplifié. En fait la pcr n'amplifie que l'ADN rétrotranscrit à partir de l'ARN de ce virus. Soit on n'est pas infecté et elle n'amplifie rien, soit on est infecté et on a de l'ADN. Si en revanche on veut savoir quel variant est présent, il faut séquencer l'ADN qui a été amplifié. Ou peut-être (probablement) qu'on amplifie pour cela un autre segment du génome du virus, celui qui contient les mutations caractéristique des variants cherchés.

  13. #10
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par MissJenny Voir le message
    pour un simple test de détection du virus, on n'en fait rien. On se contente de vérifier que de l'ADN a été amplifié. En fait la pcr n'amplifie que l'ADN rétrotranscrit à partir de l'ARN de ce virus. Soit on n'est pas infecté et elle n'amplifie rien, soit on est infecté et on a de l'ADN. Si en revanche on veut savoir quel variant est présent, il faut séquencer l'ADN qui a été amplifié. Ou peut-être (probablement) qu'on amplifie pour cela un autre segment du génome du virus, celui qui contient les mutations caractéristique des variants cherchés.
    Merci.
    Je comprends bcp mieux.

    Une autre question: J'ai lu, qu'avec le test PCR, on amplifiait 1 ou 2 segments. Mais combien de segments peut contenir un virus ? Par exemple la SARS-COV ?
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  14. #11
    MissJenny

    Re : Délai d'incubation Covid 19 avant un test PCR

    Le génome du sars-cov2 n'est pas segmenté (c'est le cas de certains virus comme ceux de la grippe). J'ai employé ce mot de segment mais j'aurais pu dire séquence. C'est juste un morceau du génome qu'on décide d'amplifier. Il faut qu'il soit assez long pour être propre à ce virus,, mais pas trop long parce que les molécules d'ADN ont tendance à se casser quand on les "manipule" si elles sont trop longues. Dans le cas du test pcr du sars-cov2 je n'ai aucune idée de la longueur de la séquence qu'on amplifie, j'imagine que c'est de l'ordre de la centaine de paires de bases.

  15. #12
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par MissJenny Voir le message
    Le génome du sars-cov2 n'est pas segmenté (c'est le cas de certains virus comme ceux de la grippe). J'ai employé ce mot de segment mais j'aurais pu dire séquence. C'est juste un morceau du génome qu'on décide d'amplifier. Il faut qu'il soit assez long pour être propre à ce virus,, mais pas trop long parce que les molécules d'ADN ont tendance à se casser quand on les "manipule" si elles sont trop longues. Dans le cas du test pcr du sars-cov2 je n'ai aucune idée de la longueur de la séquence qu'on amplifie, j'imagine que c'est de l'ordre de la centaine de paires de bases.
    Merci pour votre réponse.
    J'ai maintenant à peu près compris à quoi servait le PCR dans le cas de la pandémie actuelle.
    Et ou se trouvent les biais.
    .
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  16. Publicité
  17. #13
    Flyingbike
    Modérateur

    Re : Délai d'incubation Covid 19 avant un test PCR

    que sous-entendez vous ?
    La vie trouve toujours un chemin

  18. #14
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Flyingbike Voir le message
    que sous-entendez vous ?
    Le fait qu'on ait de faux positifs ou de faux négatifs.
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  19. #15
    Flyingbike
    Modérateur

    Re : Délai d'incubation Covid 19 avant un test PCR

    pour tout test diagnostic il y a la notion de faux positif et faux négatif.

    Pour celui du SARS-CoV2 par PCR, les faux positifs sont virtuellement inexistants.
    La vie trouve toujours un chemin

  20. #16
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Flyingbike Voir le message
    pour tout test diagnostic il y a la notion de faux positif et faux négatif.

    Pour celui du SARS-CoV2 par PCR, les faux positifs sont virtuellement inexistants.
    "virtuellement inexistants"
    Là, je ne comprend pas.

    Inexistants, je comprends.
    Virtuel, je comprend.

    "Virtuellement inexistant", dans le cas de notre PCR, là je ne vois pas ce que ça veut dire.
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  21. #17
    MissJenny

    Re : Délai d'incubation Covid 19 avant un test PCR

    c'est difficile de quantifier précisément le taux de faux négatifs parce qu'on n'a pas de "golden standard", i.e. de méthode infaillible pour décider si une personne est infectée ou non. Mais on a des estimations de ce taux, qui serait autour de 1 à 2%.

  22. #18
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par MissJenny Voir le message
    c'est difficile de quantifier précisément le taux de faux négatifs parce qu'on n'a pas de "golden standard", i.e. de méthode infaillible pour décider si une personne est infectée ou non. Mais on a des estimations de ce taux, qui serait autour de 1 à 2%.
    "Golden Standart" ?
    Est-ce un échantillon de référence parfait et complet ?
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  23. Publicité
  24. #19
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Ai-je raison d'être inquiet lorsque je lis cela sur le lien : (35 bases testées sur 30 000 du sars-cov2)
    https://www.pasteur.fr/fr/espace-pre...-du-sars-cov-2

    Extrait
    Dans le cadre du test IP2, les trois séquences sont :

    - « CTCCCTTTGTTGTGTTGT » et « ATGAGCTTAGTCCTGTTG » qui comptent respectivement 18 et 17 nucléotides (ce sont les deux séquences amorces)
    - et la séquence « AGATGTCTTGTGCTGCCGGTA [5']Hex [3']BHQ-1 qui compte 21 nucléotides (elle correspond à la séquence sonde).

    Le génome complet du SRAS-CoV-2 comprend un enchaînement de 30 000 bases, et celui du génome humain, 3 milliards. Comme le code génétique ne comporte que 4 bases (A, T, C, G), il arrive parfois que de petites séquences de nucléotides se retrouvent dans différents organismes, comme c’est le cas pour la séquence « CTCCCTTTGTTGTGTTGT ». En effet, l’homme mais aussi d’autres espèces animales comme le labrador retriever, le chat, le cochon… possèdent cette séquence dans leur génome.
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  25. #20
    Flyingbike
    Modérateur

    Re : Délai d'incubation Covid 19 avant un test PCR

    non, vous n'avez pas raison d'être inquiet.
    Commencez par vous documenter sur la technique de PCR, puis sur la technologie TaqMan

    On n'a jamais fait de PCR avec une amorce seule.

    La spécificité de la PCR diagnostique du SARS-CoV2 est extrêmement élevée.

    La détection est conditionnée à l'hybridation des amorces ET de la sonde. Et comme c'est une PCR multiplex, on rajoute encore une couche de spécificité.

    Votre source précise quand même

    Par contre, l’association des trois séquences est unique au SARS-CoV-2 et c’est cette singularité qui permet l’identification du virus dans les tests.
    Dernière modification par Flyingbike ; 08/04/2021 à 15h46.
    La vie trouve toujours un chemin

  26. #21
    MissJenny

    Re : Délai d'incubation Covid 19 avant un test PCR

    Donc c'est 35 paires de bases? ça peut être suffisant, la spécificité du test dépend de s'il y a des espèces proches (ayant donc des séquences proches) assez prévalentes dans la population testée.

    De toutes façons puisqu'on n'a pas de traitement c'est plutôt les faux négatifs qui posent problème.

  27. #22
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    C'est vrai que ma curiosité me conduit aussi à me poser la question de l'augmentation des tests positifs après vaccination du tiers de la population : USA, Chili, etc .
    C'est presque inexplicable.
    Ca devrait vraiment baisser.

    Car, si c'est la même souche, le vaccin devrait faire son effet.
    Et si c'est un variant, on ne devrait pas le détecter. Il a muté.

    Non ?
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  28. #23
    Archi3

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Nine14140 Voir le message
    C'est vrai que ma curiosité me conduit aussi à me poser la question de l'augmentation des tests positifs après vaccination du tiers de la population : USA, Chili, etc .
    C'est presque inexplicable.
    c'est tout à fait explicable, puisque la dynamique de l'épidémie dépend au moins autant du comportement des populations que du taux de vaccinés.
    Le plus dur n'est pas de piger les raisonnements compliqués, mais d'accepter les simples.

  29. #24
    Flyingbike
    Modérateur

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Nine14140 Voir le message
    Et si c'est un variant, on ne devrait pas le détecter. Il a muté.

    Non ?
    Non. Le postulat variant = non detecté est faux.

    Je ne suis pas fan de ce qui me semble être des insinuations frisant presque avec un courant complotiste.
    La vie trouve toujours un chemin

  30. Publicité
  31. #25
    FabiFlam

    Re : Délai d'incubation Covid 19 avant un test PCR

    Flyingbike,

    Je ne comprends pas: la question posée mérite une réponse scientifique non ?
    Pourquoi aller chercher midi à quatorze heure sur des supposés liens avec un mouvement complotiste ?

    Personnellement je pense savoir que contrairement aux sérologies, les PCR posent rarement des problèmes de faible spécificité puisqu'il sont justement conçus pour détecter un pathogène précis sans risque de confusion avec un autre.

    Le principal problème des PCR c'est la définition du seuil de détection non ? Donc risque essentiellement de ne pas détecter (faux négatifs) si le pathogène est considéré comme rare et que le seuil est trop élevé ou éventuellement risque de détecter abusivement (faux positifs) si le nombre de cycles d'amplification est trop élevé. C'est pour cela que la PCR n'est normalement pas recommandée en population générale, non ?

    Je crois qu'il y a une étude qui démarre car un certain nombre de résidents d'EHPAD vaccinés ont des PCR positives et ce nombre loin d'être négligeable pose évidemment question. Les personnes concernées sont apparemment en bonne santé heureusement.

    FabiFlam

  32. #26
    Flyingbike
    Modérateur

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par FabiFlam Voir le message
    Flyingbike,

    Je ne comprends pas: la question posée mérite une réponse scientifique non ?
    Pourquoi aller chercher midi à quatorze heure sur des supposés liens avec un mouvement complotiste ?
    ben, quand je lis ça :

    Citation Envoyé par Nine14140 Voir le message
    Ai-je raison d'être inquiet lorsque je lis cela sur le lien : (35 bases testées sur 30 000 du sars-cov2)
    https://www.pasteur.fr/fr/espace-pre...-du-sars-cov-2

    Extrait
    Dans le cadre du test IP2, les trois séquences sont :

    - « CTCCCTTTGTTGTGTTGT » et « ATGAGCTTAGTCCTGTTG » qui comptent respectivement 18 et 17 nucléotides (ce sont les deux séquences amorces)
    - et la séquence « AGATGTCTTGTGCTGCCGGTA [5']Hex [3']BHQ-1 qui compte 21 nucléotides (elle correspond à la séquence sonde).

    Le génome complet du SRAS-CoV-2 comprend un enchaînement de 30 000 bases, et celui du génome humain, 3 milliards. Comme le code génétique ne comporte que 4 bases (A, T, C, G), il arrive parfois que de petites séquences de nucléotides se retrouvent dans différents organismes, comme c’est le cas pour la séquence « CTCCCTTTGTTGTGTTGT ». En effet, l’homme mais aussi d’autres espèces animales comme le labrador retriever, le chat, le cochon… possèdent cette séquence dans leur génome.
    Alors que le lien explique clairement que la PCR est spécifique, j'ai spontanément l'impression que la personne cherche davantage à mettre en doute les méthodes et leurs interprétations qu'a essayer de comprendre et se documenter.

    Citation Envoyé par FabiFlam Voir le message
    Personnellement je pense savoir que contrairement aux sérologies, les PCR posent rarement des problèmes de faible spécificité puisqu'il sont justement conçus pour détecter un pathogène précis sans risque de confusion avec un autre.
    Il est difficile de comparer la spécificité de ces deux méthodes, mais l'avantage majeur de la PCR est que sa spécificité peut être quasiment totalement anticipée in silico, contrairement aux tests sérologiques.

    Le principal problème des PCR c'est la définition du seuil de détection non ? Donc risque essentiellement de ne pas détecter (faux négatifs) si le pathogène est considéré comme rare et que le seuil est trop élevé ou éventuellement risque de détecter abusivement (faux positifs) si le nombre de cycles d'amplification est trop élevé. C'est pour cela que la PCR n'est normalement pas recommandée en population générale, non ?
    En théorie, la sensibilité de la PCR est supérieure aux tests sérologiques. In vitro, et dans certaines configurations in vivo, on peut détecter aussi peu qu'une seule molécule d'ADN cible. Le problème est que cette sensibilité est fortement altérée par la complexité (génétique, biochimique) de l'échantillon. Pour définir un seuil de détection réel, il faut confronter la méthode à une méthode de référence qui n'existe pas. L'alternative est de réaliser le test sur des échantillons dont la quantité de matériel recherché est connue car ajoutée "a part".
    La difficulté supplémentaire avec la PCR sur prélèvement nasopharyngé, c'est que l'échantillon est bien moins "standardisé" que ne l'est un prélèvement sanguin, par exemple. C'est aussi pour cela qu'on se contente de définir une présence/absence de signal alors que la technique est théoriquement parfaitement quantitative.
    La vie trouve toujours un chemin

  33. #27
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Flyingbike Voir le message
    Non. Le postulat variant = non detecté est faux.

    Je ne suis pas fan de ce qui me semble être des insinuations frisant presque avec un courant complotiste.
    Je suis un papa et un fils inquiet, très inquiet.
    Je cherche des réponses scientifiques à des problèmes auxquels nous n'avons pas de réponse de la part de ceux dont c'est le rôle.

    Dites-moi les mots qu'il ne faut pas écrire pour que la censure n'ait pas à intervenir.
    Dernière modification par Nine14140 ; 09/04/2021 à 09h28.
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

  34. #28
    Flyingbike
    Modérateur

    Re : Délai d'incubation Covid 19 avant un test PCR

    je crois que concernant votre inquiétude sur la spécificité, la réponse a été donnée. Si vous voulez des précisions, il ne faut pas hésiter.


    Il n'y a aucune question qui ne soit pas la bienvenue sur le forum. Il faut juste respecter la charte et rester factuel.

    Dans le contexte de l'épidémie de Covid-19, les informations scientifiquement valides sont peut être noyées dans la masse mais la transparence est bien là, comme il se doit.
    La vie trouve toujours un chemin

  35. #29
    yves95210

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par FabiFlam Voir le message
    Je crois qu'il y a une étude qui démarre car un certain nombre de résidents d'EHPAD vaccinés ont des PCR positives et ce nombre loin d'être négligeable pose évidemment question. Les personnes concernées sont apparemment en bonne santé heureusement.
    Il me semble que ça n'a rien de surprenant : les essais cliniques n'ont pas permis de mesurer l'efficacité du vaccin contre l'infection (éventuellement asymptomatique) mais seulement contre l'apparition de la maladie (symptômes) et contre les cas graves. Je suppose qu'il y a des études en cours en population réelle (Israël en particulier), mais je n'ai pas vu de résultats publiés.

    J'ai noté que dans la modélisation de l'impact de la vaccination réalisée par les épidémiologistes de l'institut Pasteur, le scénario le plus favorable est basé sur une réduction de 80% du risque d'infection, donc assez loin des 100%. Je ne sais pas d'où ils tirent ce chiffre (ils mentionnent juste que "des données récentes suggèrent que les vaccins pourraient également réduire la susceptibilité de l’ordre de 80%"), mais il n'est certainement pas tombé du ciel.

  36. #30
    Nine14140

    Re : Délai d'incubation Covid 19 avant un test PCR

    Citation Envoyé par Flyingbike Voir le message
    je crois que concernant votre inquiétude sur la spécificité, la réponse a été donnée. Si vous voulez des précisions, il ne faut pas hésiter.
    Oui, je vous remercie les différents intervenants pour leurs réponses.

    Je suis sur ce forum depuis qqes années principalement au sujet de physiologie sportive.

    Cette fois-ci, je suis revenu au sujet du test PCR car Futura apparaît sur google quand on tape "PCR".
    Oui, je voulais comprendre ce test.

    Alors, je comprends bcp mieux.

    Mais il me reste le terme "amplification" à comprendre.

    Alors pour ce test PCR.
    OK, je vois bien qu'on a des séquences de référence.
    Je suppose donc que l'objectif final est de chercher à savoir si la ou les séquences de référence se trouvent ou non dans l'échantillon.

    Si c'est cela, j'appellerai cela de la détection.
    "Détecter si on retrouve des séquences d'adn données dans l'échantillon"
    Non ?

    Et je suppose que si dans l'échantillon, on retrouve un milliards de fois la séquence de référence, on pourra créer au maximum 1 milliard de séquence ADN dans le produit final appelé produit amplifié.
    Est-ce cela ou je n'ai pas encore tt compris ?
    .
    .
    PS
    Oui, oui. Je suis hyper curieux.
    Ca existe sur terre, des humains hyper curieux, un peu bizarre.
    Acceptez cette bizarrerie sans la prendre pour du complotisme.
    .
    Alors, je demande juste aux personnes qui ont parfaitement compris ce qu'est le test PCR de l'expliquer à quelqu'un qui va vite comprendre si l'explication est cohérente.

    Perso, lorsque je veux expliquer qqe chose d'un peu complexe, j'utilise le plus souvent des schémas.
    Allez voir mes articles sur la physiologie. Je crois que M. flyingbike est souvent intervenu. Pour la physiologie, je venais + pour exposer une théorie scientifique qui m'est propre (car humain bizarre).
    L'important n'est pas uniquement le but mais principalement le chemin qui y mène.

Page 1 sur 2 1 DernièreDernière

Discussions similaires

  1. QR - Dépistage de la Covid-19 : qu'est-ce que le test PCR ?
    Par RSSBot dans le forum Covid-19, SARS-CoV2 : actualités et discussions
    Réponses: 2
    Dernier message: 07/04/2021, 16h32
  2. QR - Dépistage de la Covid-19 : qu'est-ce que le test PCR ?
    Par RSSBot dans le forum Définitions et Questions / Réponses
    Réponses: 0
    Dernier message: 15/09/2020, 10h40
  3. Delai résultat covid au laboratoire
    Par 24061990 dans le forum Santé et médecine générale
    Réponses: 4
    Dernier message: 25/08/2020, 10h37
  4. Délai d'exposition de la paille avant pose de l'enduit
    Par trinle66 dans le forum Habitat bioclimatique, isolation et chauffage
    Réponses: 3
    Dernier message: 05/09/2011, 16h47
  5. Delai test
    Par choupine04 dans le forum MST : SIDA, syphilis, hépatite...
    Réponses: 1
    Dernier message: 06/06/2010, 21h43