Répondre à la discussion
Affichage des résultats 1 à 1 sur 1

Question sur la séquence d'un certain gène virale




  1. #1
    maissiou23

    Question sur la séquence d'un certain gène virale

    bonjour,
    j'ai un problème à résoudre, mais je ne sais pas si je suis sur le bon chemin:

    voici l'énoncé:

    Voici la séquence d’ADN d’un gène virale qui code un petit peptide. La séquence d’ARNm synthétisée à partir de cet ADN est aussi montrée.

    5’ -AGCTCATGTGCGAGTCCTGACGCTGACTAG G-3’
    3’- TCGAGTACACGCTCAGGACTGCGACTGATC C-5’

    Séquence d'ARNm mature (G* = coiffe 5’)
    5’-G*UCAUGUGCGAACGCUGACUAGGAAAAAA . . . -3’


    voici la question:


    i) Dans la séquence génomique montrée ci-haut, mettez des parenthèses autour des deux exons dans le gène. combien d'a.a résultants? Est-ce que c’est plus probable que ce virus se réplique dans des cellules procaryotes ou eucaryotes?

    ma réponse:

    5’ -AGC (TCATGTGCGA) GTCCTG (ACGCTGACTAGG)-3’
    3’- TCGAGTACACGCTCAGGACTGCGACTGATC C-5’
    Séquence d'ARNm mature (G* = coiffe 5’)
    5’-G* (UCAUGUGCGA) (ACGCUGACUAGG) AAAAAA. . . -3’

    3 solutions possible:

    5’-G*UC AUG UGC GAA CGC UGA CUAGGAAAAAA. . . -3’
    coiffe 5'-Met-Cys-Glu-Arg-Stop-Leu-Poly(A)

    5’-G*UCA UGU GCG AAC GCU GAC UAG GAAAAAA. . . -3’
    coiffe 5'-Ser-Cys-Ala-Asn-Ala-Asp-Stop-Poly(A)

    5’-G*U CAU GUG CGA ACG CUG ACU AGGAAAAAA. . . -3’
    coiffe 5'-His-Val-Arg-Thr-Leu-Thr-Arg-Poly(A)

    La dernière est la plus probable, selon moi, car il n'y a pas de codon stop. (C'est une séquence d'ADN....non aux extrémités?)

    donc, on peut dénombrer 7 a.a.

    par contre, est-ce que chez les eucaryotes ou procaryotes....je n'ai pas la moindre idée.


    Est-ce que quelqu'un pourrait me donner une piste s'il vous plait?

    merci

    Il existe une section excercice en biologie, pourquoi ne pas s'en servir??? message déplacé. Yoyo

    -----

    Dernière modification par Yoyo ; 07/02/2010 à 10h44.

Sur le même thème :

Discussions similaires

  1. [Biologie Moléculaire] know out d'un géne
    Par cysto dans le forum Biologie
    Réponses: 3
    Dernier message: 23/01/2010, 12h17
  2. [Licence (L1-L2-L3)] Sequence d'un peptide:Glx et Asx
    Par liban26 dans le forum Exercices en biologie
    Réponses: 2
    Dernier message: 17/06/2009, 12h06
  3. [Licence (L1-L2-L3)] Sequence d'un peptideP
    Par liban26 dans le forum Exercices en biologie
    Réponses: 1
    Dernier message: 22/04/2009, 09h42
  4. [Biologie Moléculaire] Séquence du promoteur du gène résistance à l'ampicilline
    Par lilou41 dans le forum Biologie
    Réponses: 8
    Dernier message: 11/09/2008, 18h49
  5. [Génétique] Définition d'un séquence
    Par sahra dans le forum Biologie
    Réponses: 2
    Dernier message: 03/09/2003, 19h29